Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23279  (registered. 2007)
Contig Information
Length 2705 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_RDr Root of dessiccated seed 6
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit respiratory burst oxidase-like protein J [Hordeum vulgare subsp. vulgare]
Score 1166
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23279
TGCACACGCTTCGCCCACGTCACCTGCGACTTCCCCAGGCTCATCTCCTGCCCGAGCGACAAGTTCATGGCCCTGCTGGGCCCCAACTTCGGCTTCAGGC
AGCCGACGTACCCGGACCTGCTGGCCAGCGCCCCAGGGGTCACCGGCATCCTCATGATCATCATCATGACCTTCTCCTTCACGCTGGCCATGCACACCTT
CAGGCGGAGCGTCGTCAAGCTGCCGTCGCCGCTGCACCACCTGGCCGGCTTCAACGCCTTCTGGTACGCGCACCACCTGCTGCTGCTCGTCTATGTCCTC
CTCGTGGTGCATTCCTACTTCATATTCCTCACCAGAATCTGGTACAAGAAGACGACATGGATGTTCCTCATAGTCCCTGTCCTCTTCTACGCCTGCGAGA
GGATTATCAGAAAAGTTCGCGAAAACAACTACCACGTGAACATTCTCAAGGCTGCGATTTACCCAGGAAATGTGCTCTCTCTTCACATGAAGAAGCCACC
GGGTTTCAAGTACAAGAGTGGGATGTACCTGTTTGTGAAATGCCCTGACGTTTCGCCTTTCGAATGGCATCCGTTCTCCATCACTTCTGCACCTGGAGAT
GATTACCTGAGCGTGCATATCCGCACGCTAGGTGACTGGACATCTGAACTCAGGAGCTTGTTCGGGAAGTGTTGCGAGGCACAAGTTACTTCCAAGAAGG
CCACCCTTTCGAGACTTGGAAACTACCAGTTGTGGCAGACTCTGCGACAGAAGACACCAGGTTTCCTAAGGTCTTCATCGATGGCCCTTATGGTGCACCG
GCGCAAAATTACAAGAAATACGACATTCTTTTGCTTATCGGGCTTGGAATTGGCGCCACTCCTTTCATCAGCATATTGAAAGATCTCTTGAACAACATAA
AGTCCAATGATGAGGTGGAAAGTATACACGGTTCTGAGATAGGCAGCTTCAAGAACAGTGGGCCAGGGAGAGCTTACTTCTACTGGGTTACCAGAGAGCA
AGGATCCTTCGACTGGTTCAAAGGAGTCATGAATGAAGTCGCTGACAACGATCACAGCGATGTCATAGAGATGCACAATTACCTCACCAGCGTGTATGAA
GAAGGCGACGCAAGGTCAGCGCTGATTGCCATGGTTCAGTCACTCCAGCATGCCAAAAATGGTGTTGACATCGTCTCCGGAAGCAAGATTCGGACACATT
TTGCAAGGCCTAACTGGAGAAAAGTGTTCTCTGATTTGGCCAATGCCCACAAGAACTCTCGTATAGGTGTTTTCTATTGTGGATCTCCAACACTCACGAA
ACAACTCAAGGATCTTTCAAAAGAATTCAGCCAGACAACCACAACTAGGTTCCATTTCCACAAGGAAAACTTCTAATGCCATACCCGAAGAATTTCAAAC
AGTTTGCAGATATACTTGTATAGGAAAAGAAATATGGTAGCGCTCGAATAGTAAATATAGCTTTACAAGTTTTGTTGTGCGCTGGGTTGTACAAAGTACA
TTGAAAGCTAGTGTCACCAGCATACATAGACTGGAATATTTAGAAATATCTGTATTGTAACAGTGAGATTGATTGTTAGGTTATGCCCCTCGAACACGCA
AGCTTTCTCTCTTCAGTTTTTCTGCCCTGACAGTCTCTGCATTGCGCTTATGAACACTACTCTCCCCAGATATGTTCTTTTCTTTTGGAGGTCTGCCTCT
TTTTTTAGGTTCAATGTCACCTGATACTGATATAGTTCTATCCTTTCGAGGCCTGCCCCTTTTTTTAGGCTGATATACCTCTTCAGTTTTTCTTTTGGAG
GTCTGCATCTTCAGTCTTTCTGCCCTGACAGTCTCTGCATTTGACGGGGACGCCTGAAGCAACCCTGGTAGTGGTAGGTTGTTTGACTGTTGGCCATTTA
CTGCTCTAACCACCATCTGGTTGCTAGTACCATTAGTTCCTTGCGATGATCTAGCCCCCTTAAGTCTGTAGTCAGGAACAGCATTCTGATGTTTGAATTT
GTCCATAACAAGTTTTCTGAGTGGAATGGTTATGTCCAATGGTAGCAGGATCTCCTCCAGTTCAAGCCATTCAAGATCTTCCTGGTCTCCATCATCATAG
ACAACACTGTACCAATTGCTTTCACTGTCATACTTGACAACTTTCCCTGCAAAATACTTGTCTCCAAACTGCTTTCTCACTTTCCGCCCTTCTAGCCATT
CACCAAAGCGATGATCAACTCGAGATCCTGGAGCATCTCTTACTGCAGGTTGTGAACCAGATGCGAAATCAGGAGGCAAGTCTGGGACACCATTGATAAT
GACAGCAGGCTCCCTGGGTACTATGACAACAGATGCAGTGTCTGACTCTTGCATGTTCTTACTCCCCTCCATGACCTGATATTGCACCAATTCCTTGGAT
TTAGCTAGAAACAACCTCGTGCTTGGCGGCGGCGGGGGCGGGGCGGCGGCGGTGCCTCTGCGAGGAGGTCTGTGCTCGAACGGCTCCGGGGGGCGGCTGG
TACGCCCGCTACTGGGTGGAGCGGGGACGGAGCTCGCAGGGGCGCACAAACCCTAGGTCGGGATGAGAAGGGCGGGGTGGAGCCGGAGGGCTGGACCCGA
GACCCGAGAGGAGTAGGGTTGTACGCCGGAGGAGCCCGGCTAGAAGTAGCGGCCCCGGCTGCTGCGCAGGAGGGGAGGGGACCGACGTTCCTCGGCCGGA
TCGAC
page-top