Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23268  (registered. 2007)
Contig Information
Length 623 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0205400 [Oryza sativa (japonica cultivar-group)] >gi|40253404|dbj|BAD05334.1| putative copper chaperone [Oryza sativa Japonica Group] >gi|42761303|dbj|BAD11546.1| putative copper chaperone [Oryza sativa Japonica Group] >gi|113623203|dbj|BAF23148.1| Os08g0205400 [Oryza sativa (japonica cultivar-group)] >gi|125560525|gb|EAZ05973.1| hypothetical protein OsI_28214 [Oryza sativa Indica Group] >gi|125560528|gb|EAZ05976.1| hypothetical protein OsI_28217 [Oryza sativa Indica Group] >gi|125602535|gb|EAZ41860.1| hypothetical protein OsJ_025343 [Oryza sativa (japonica cultivar-group)] >gi|215769428|dbj|BAH01657.1| unnamed protein product [Oryza sativa Japonica Group]
Score 343
Evalue 9.92787e-31
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23268
TTTTTTTTTTCACACAGACGAAATTACCAGTTTGCTATTATTTGCAGTAAATTCATGGTGCATATACCATCCGACCAGAAAATCATGTCCTTGCAAAGCA
TTTCAACTGGGCCATTGTTACATTAAACTTCACAGTTTACATATTAGAGATGCCTTTTTAGGACGAAACAGCAGATGCCGAGGGTTCAGCCTCCCAGAAC
GATGTCTTCTTGCCTGTCTTCGAAACAGTCTGCAGAACAGCATCCGGCGTCACATTACCCTTCACAGTGACCTTCTGCTCCTTGATGTCTACATCGAAGG
ACTCAACACCTTCCATTTTGCCAAGAACCCGCTTAACAGCTCCAACACATCCCTCACATGACATGCCAACCCTGAGTTCAACAGTCTGAGACATTGCGTG
CGAAATCGGTTGATCCGCGGACGGCGAGGGCGCAGAGGGATGGGGAAAGGAAAAGTTGGGTGTGAGGTCGGAGGGGTTGGACGACGACGACGGCTCGGGG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGANANANAGAG
AGAGAGAGACANANANAGAGAGA
page-top