Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23252  (registered. 2007)
Contig Information
Length 769 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 9
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|21104591|dbj|BAB93184.1| unknown protein [Oryza sativa Japonica Group] >gi|113534192|dbj|BAF06575.1| Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|125528208|gb|EAY76322.1| hypothetical protein OsI_04255 [Oryza sativa Indica Group] >gi|125572471|gb|EAZ13986.1| hypothetical protein OsJ_003811 [Oryza sativa (japonica cultivar-group)]
Score 571
Evalue 5.67514e-57
Total Hit Count 28
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23252
CCTCGTGCCGGTGAAGGAGAACTCAAAAAACCCAGCCGATCAAGCCATGGCCATGAGGGCTCTCGCGCTTTCCCCGTCCCAGAGCTCCTCATTTGGGCTC
CACCAGAGTATGCCCTCCTTCAAGCCAAGCAGCACCAGTCCTGCTAGATCAGTCAGGGCCTATGCGAAAGCGGATGAGCAGGAGGAGAAGAAGAAGGTGC
CCAAGCAGTCCTTGTTTGGGAACATCACCGAGGCGCTGGACTTCTCGCAGGTCCGGTCGGAGAAGGATGCGGAGCTGCTGTATGAGGCCAGGGATTCCAT
CAAAGATGAAGGAAGGATGACAAGGGAACAGTATGCAGCCCTTCGGAGGAAGATTGGTGGCACCTACAAGGATTTCTTCAAGTCATATGTTGAAGTTGAC
GGTGAATACGTGGAGGAAGGTTGGGTGGACAAGACCTGCAAAGTTTGCAAGAAAGACACAAGAGGGGAGCCAAGGCAAGTTGACAATCTAGGAAGATATA
TGCATGTGGCGTGCGCAGAGAACTCGAAACCAACAAACTTCTTTTCCAAGCTCTTCGGCAGATGAACTTCTTTTGTACCATCAAACCCGTTGTTCGACTC
ATGGTTAGATAAATAGATGGATGCTATAACACCAAGGGATTAGGACAGTAATGTGTACTGTGTTGTTCATGTGAAATGGTTTTTGATGAGCATATATACA
CATTCCATTATCCAATTTCGTTGGTATATCAAGTAGCACCATGAACAGAGGCCTGATTTATGGAGAAAT
page-top