Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23238  (registered. 2007)
Contig Information
Length 953 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0913000 [Oryza sativa (japonica cultivar-group)] >gi|20161376|dbj|BAB90300.1| putative thioredoxin F [Oryza sativa Japonica Group] >gi|113534698|dbj|BAF07081.1| Os01g0913000 [Oryza sativa (japonica cultivar-group)] >gi|125528816|gb|EAY76930.1| hypothetical protein OsI_04888 [Oryza sativa Indica Group] >gi|125573075|gb|EAZ14590.1| hypothetical protein OsJ_004415 [Oryza sativa (japonica cultivar-group)] >gi|215715230|dbj|BAG94981.1| unnamed protein product [Oryza sativa Japonica Group]
Score 610
Evalue 2.46681e-61
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23238
GATGCTTACATCTGTAAGAACAAGATTTTTTTATATATGTTTTGCAAAACATGCTTGGTAGGCCTGCAAATTAGTGAGATCAGGAAGCAACCGTATTTTC
AGAAAGATTTAAATGACTATTTACAGCATACACTCCACATGGATGGGTGTATATTGTCCAGAACGATTGGTAAATCATCATAAGCAGAAGAACTATAATA
ACTGTTTTTCTCCACGGTGATTATCCACTTCCACAAAGGCTGTTTTCATCCCATAGTGTACACTAGTGATAGCATGCTAACTGGTGCATTTCTTTCCAGG
GAATTGCTCAGCTTGACTTCACTTCCTCAATCGCACGTGCTAATTCATCAATCTTCGCACCAGTGACCTCCTTTGCAACCTTCCCATCCTTGAAAATCTT
GAATGTTGGTACAACCCTTATGCCAAGCTCCTTTGCAAGAGGCCTGTTGTCTTGATTGCAATCGAGCTTGAGGAATACGACGTCGTGGTCCTTCTCAGAC
ATCTCCTGGAATTTTGGTGCCATAACTTTGCAAGGGCCGCACCATTGGGTGTACATGTCGAGGACGACGGGCTTCTCCCCTGCTGCCTTGACAATTGGCC
AGAAGGTGTCCTTGCAGACCTCCGTGACCTGCCCGGTCACCGCCACCGCCGCTGTGGGCGCTTCCACCTCGTCGGCTCCCGTCGTGGCCGTCTCCAAGCC
GCCCGACTTCACCGGAGCCACTCCCCTCCCGTCAGAGCCGGACACCACCATCAGGCTCCTCTTCTGAGAAGCGGCCACGCAGGCCAGGAAGCGGCCGCAG
GCGGCGGGGCGGCATGAGGAGATGGCCGGCGAGGAGGCCGTGCTCTGCGGCGAGGAGACGGAGAGGCGTAACGCCATTGGATGCTGGAGTTTTGGAAGGT
AACGCCCCCAACGGGTGGTGTTAGTTGGTGGTGTACAGAGTGGTGTTTTCCTG
page-top