Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23233  (registered. 2007)
Contig Information
Length 1756 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0818000 [Oryza sativa (japonica cultivar-group)] >gi|113534158|dbj|BAF06541.1| Os01g0818000 [Oryza sativa (japonica cultivar-group)] >gi|215687256|dbj|BAG91821.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697641|dbj|BAG91635.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1838
Evalue 0
Total Hit Count 191
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23233
CTCCGCCGGCGGCTCGGCTCCCTCCCCTCTGCCTCCTCGGTTTCCTGAAGAATCGTGTGGGTCCTGCTCGTGAGGGCTGCGAGGGAAGGGGGAAAGGAGA
GGGCTCGAGTCGAGTCGATCTGGGCGAGGCCATGATGGAGAGGAGGTCGCTGATGGAGGCGCTGGTGACGGCGGCGCAGGGAGGCTCCACGGACACGTCG
GTGCTGTCCATGCTCAAGTACGCCGTGCTGCCCATCGCCAAGGTCTTCACCGTCTGCTTCATGGGCTTCCTCATGGCCACCAAGTACGTCAATATCCTCC
AGCCCAACGGCCGGAAGCTTCTCAACGGGCTTGTGTTCTCGCTTCTACTTCCTTGCCTTATATTTTCCCAACTGGGCAGCGCAATCACGCTCGAGAAGTT
GGTGCAGTGGTGGTATATTCCAGTAAATATTGTTGTAGGCGCCGTGTCTGGCTCCTTGATTGGCTTTGTGGTGGCATCTATCATCCGACCTCCTTATCCG
TACTTCAAGTTTACTGTTATTCACATTGGAATAGGGAACATTGGAAATATACCTCTGGTTCTCATTGCAGCATTATGTCGGGACCCATCCAATCCTTTTG
GCGACTCTGAAAAATGCAGCCAAGATGGAAATGCATACATCTCATTTGGTCAATGGGTTGGTGCGATTATTGTTTACACATATGTGTTCAAGATGCTTTC
TCCACCACCAGGAGAGACCTTTGATGGTGAAGAGGAGAAGCTTCCGGTTCTGGCATCTGAAGAAAACGCGATGCCTGAACTAGGTAAATATCCAACAGGC
ACTCACACTAGTACTGTACCCGAGGATGAGCCTTTGTTAGCTCTCGAGGGGAATCAAAAAGGCGCTACTTCTCTAGGATCAAAGATATTAAGCTGTGTTA
GATGTGTGGTGAAATTCCTAAAAGACAAGCAACTTCTTCAGCCACCAATTATTGCCTCTGTCTTTGCAATTGGAATCGGTGTTGTTCCATTCTTGAAGGG
TTTGATATTCACGGATGATGCACCTCTATTCTTCTTCACAGACAGCTGCCTCATTCTTGGGGAAGCTATGATTCCATGCATTTTGCTTGCTGTGGGGGGT
AATCTTGTTGATGGTCCTGGTGAAGGGAGTAAAAGACTTGGTGTGCGGACCACCGTTGCTATTATTTTTGCACGGTTGATCTTGGTTCCAATTGCTGGGG
TTGGCATCGTCATGCTAGTTGACAAACTTGGTTTCATTCCCAAAGATGACAAAATGTTCAAGTTTGTTCTACTACTGCAGCATTCCATGCCCACATCAGT
GCTCTCAGGTGCTGTTGCAAACCTCAGAGGGTGCGGGAAAGAATCAGCCGCGATCTTGTTCTGGGTGCACATTTTTGCAGTGTTCTCCATGGCGGGGTGG
ATTATTTTCTACTTGACGTTGCTCTTCTAAATACTGCATTCAACTTGAATATCCGCAAATAGTAGATATCATCAGAAAACATGGAAGAAGATAATAGTGT
GTCATGAACTGTACAATAGGCCACCGAAACCATGGTGGCAGCTGCTCTGGAGGTACGAGTTGTATCAGTACAGATATGGGTTCCTCGTACCCGGTTTGTG
TAAATGCCTTTGTCATGTTAATTTTGGCCTTGTTCCTCTGCCACTTGTCATGGCGAGGGACGAGAATCGCCGGCATCTGGTGCCTGCCCATATTATTAGG
TCGCCCTGAAAAACCTTTTAGATCCGTATTTCAGATATATTTTGGCAAAAAAAAAA
page-top