Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23226  (registered. 2007)
Contig Information
Length 1109 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195609644|gb|ACG26652.1| GTP-binding protein SAR1A [Zea mays] >gi|195653011|gb|ACG45973.1| GTP-binding protein SAR1A [Zea mays]
Score 859
Evalue 4.20862e-90
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23226
TTTTTTTTTTACACAGCAAAAACTGAGCAAACACAAGGCTCAGCGCACTTCTCGATGGACAGGGTTGCTCAAAAAGTTTCACCAACATAATCTAAGCTGG
TGGTAACAAACATTTCACCGACTGAGATGACAGATTACAATAGCTGAGACACTTCCCATAGTCTACAACTGATCCCAGCAACCGCATTGTAACTAGTAAA
ATCACATTACACACGAACTGTCAAACAAATTTACGCAACCATATATCTAGGATTATCGTCAACTTACAGGTTTTCCCTATCACTAAGATAAATCTTTTCT
TGCAGCTGCAGTTCTCCCCAGAGCATCAAGGATGATGAGACGGGCAAAGAACCAGGACCTGAATATTGCCACGGTGGACAGCAGGAAGGCCCTTCACTTG
ATGTACTGGGACATCCATTTGAAACCTTCACCATAGCCCATCTTGCGGACGATGCTGCACATGAACACCTCCAGGGGCCGCACATTTGAATCCGACAAGT
TCACGTTGCCCTTCCCAGTGGTGAAGTTGCTCAGCCCAAGGTAGTAGCGCAGCTCCTCCTCGGATGCTGCGATAGGTATGTCGATCTTGTTACCCAGTAC
GAGGAAAGGCACATTCGCAAGGGAGTCATCTGAAAGAAGGCCGTCGAGCTCCTTCTTCGACTCGGCAAACCGTTCCTTGTCAGCAGCGTCCACCAAGTAA
ACAACCGCATCCACCTTGGCGTAGTAGTCCTTCCAGACTCGGCGGGCGATCTGGTGGCCACCGAGATCGAAGGTCTTGAACTTGATCTGGCCGATGCTCA
GCTCCTCGGACGTCGGGTACTGCGTCGGCTGGTGCTGCACCAGCCGCTCGTCCTTGAGCATGTGGAGGAGGGTGGTCTTGCCGGCGTTGTCCAGGCCGAG
GAAGAGGATCTTGGCCTCCTTCTGCCACAGCCCCAGCGACGCCAGCACCCCGTAGAACCAATCCACCAGAAACATCTCTTCTCGTCCGCCTCCTCTTCTC
CGGCGATCTCTTCCTCTTCCTCCTCACACCGAACGACCGGTCGACGCTCGCCTCGACCTCCCTCCCTCTCTCTCTCTCTCTTTCTCCCCCTCGCTGGCGG
CACGAGGCC
page-top