Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23189  (registered. 2007)
Contig Information
Length 1070 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0803000 [Oryza sativa (japonica cultivar-group)] >gi|29150380|gb|AAO72389.1| synaptobrevin-like protein [Oryza sativa (japonica cultivar-group)] >gi|108711613|gb|ABF99408.1| Vesicle-associated membrane protein 724, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550077|dbj|BAF13520.1| Os03g0803000 [Oryza sativa (japonica cultivar-group)] >gi|218193933|gb|EEC76360.1| hypothetical protein OsI_13946 [Oryza sativa Indica Group]
Score 959
Evalue 1.00819e-101
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23189
ACATAGAACAAAGGCGTCAAGATCCAAGCTATACATACATAGCGTCCAAAAATACACGACCCGCCGACCCAGCCACCACCCATCCAGCGGTAACCGAACA
TCCCAACACGACGACAACGAAAACACAGACCCACCCACAGGCACCACGGCCCGGGCCAGCGCACACTAGACAAGAAAAGAACTAAGCACCATATATATGG
TTTTTGCTCGAATCAGCAGAGTAATATAGGGGCAGTTGAATGTGTCTCGCGACCTCGACTTGTCCTCACTTCTTGCCGCAGTTGAATCCGTGGCACACCG
ACAGGATTATGATGAGGATGAGCGCGACGATGATGCCCAGGACGATCAGCTTGATCTTCATGTTTTGTAGCCACATCTTTCTCCTCACCTGTGTTCCTTG
CTGCCTGAAATCTTGGGCCTGTGAGCGGAGATTCTCTGTTTTGTCAACAAGCAGCTCAATCTTCTCACCACGATCAAGAACCTTCTCAATGTTTTCCATC
ATCACGTTTTTCACTTCTGAAACTTGTGCTTGCACTTTAGCAAGCTTGTTTATCTCTTCAGGGTGGTCCACACAGTACTGCATGTGCTCTTTGAGTTTTG
ATCCAAACTCTCTGTTGAGGCTGCTTGGTGCAGCAGTAGCAGCTTTCCCGCCAGCATATCTCTTGCTGAAATCATCCTTAACCCGAACCAAGAAAGCAAT
TGGCATCTGTTGCCCCACTGATTCAACGGCAACCACACAGTATGTGAAGCCGTCCTCGACGAGGTAGTTGAAGGTGTGGCCGTCGCAGTTGTAGGTGAAC
TTGTTGTTGCTGGCGGGGAGCTTGACGAGGCACTGGGAGGCGATGGTGGTGAAGTTGCCGGTGAACTCGGTGTACTCGGCCAGCACCACCGTGCCGCGGG
CCACGAACGCGTAGATGAGCGACTGCTGCCCCATGGCTCCTCCCGCTCGCTTCGCCGCCTCTCCGCTCGAGCACGCCGCCGGTGGGGGAGGGGGGCTGCC
GGATTGGATCTCGGCGAGGCTGCTGCGGGAGGGGAGGTGGGATGGGAAGGGGGAAAGGTCGGTTTCGCTT
page-top