Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23187  (registered. 2007)
Contig Information
Length 1707 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|38344536|emb|CAE02442.2| OSJNBa0027P08.4 [Oryza sativa (japonica cultivar-group)] >gi|38344584|emb|CAE02431.2| OSJNBa0058G03.7 [Oryza sativa (japonica cultivar-group)] >gi|113564465|dbj|BAF14808.1| Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|125590511|gb|EAZ30861.1| hypothetical protein OsJ_014344 [Oryza sativa (japonica cultivar-group)] >gi|215694007|dbj|BAG89206.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1663
Evalue 0
Total Hit Count 425
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23187
GGTCTGAACCCTCTCGCGCCGCCGCCGTCGCCGCCGTCGCTGTCGCCGTCCCGTTCTCCATCTCGTCGCGCCTCCGCCGGCCTTTCAGTTTAGGGTGGGA
TCATGTCTTCTGCAATGGAGTCATCGTACCTTCCTGCTACTACTGAGTCAATTGAAAAAGCTCAGGAGGCTAAGGATGCTTCAGAGTCAATTTCGATCCT
TTACCGCGTGATCCAAGACCCGTCTTCATCTGCAGATGCACTGAGAACAAAAGAGCTTGCGATTACCAACCTTACAAACTCCCTCACTAAAGAGAACCGT
GCCGAGGATCTGCGAAATCTCTTGACCCAGCTGAGGCCGTTTTTCTCACTGATTCCCAAGGCCAAGACTGCAAAAATTGTCCGTGGAATCATTGATGCTG
TCGCCAAGATTCCTGGAACATCTGATCTTCAGATCTCGCTCTGCAAGGAGATGGTGGAATGGACGCGTGCAGAGAAACGTACGTTCCTCAGGCAGCGTGT
GGAGGCAAGGTTAGCGGCCCTTCTTTTGGAGAATCAGGAGTACACTGAAGCCCTGACCCTCCTTACTGGACTTATCAAGGAAGTCAGGAGACTTGATGAC
AAGTTGCTTCTTGTGGACATTGACCTTTTGGAAAGCAAACTCCACTTCTCTCTGAGGAACCTGCCTAAGGCCAAAGCTTCACTGACCGCTGCAAGAACAG
CGGCGAATGCCATTTATGTCCCACCAGCTCAGCAGGGCACTATTGATCTGCAGAGTGGAATCCTTCATGCGGAAGAGAAGGACTACAAAACTGCTTACAG
CTACTTCTTTGAAGCATTCGAGGCTTTCAACGCACTGGACGACCCAAGAGCTATCTTCAGCTTGAAGTACATGCTCTTGTGCAAGATAATGGTCAACCAG
GCTGACAATGTTGCTGGAATAATCTCATCTAAGGCTAGCCTGAAGTATGTGGGTCCTGATGTTGATGCTATGAAAGCTGTGGCTGATGCCTACTCTAAAA
GATCTCTCAAGTACTTTGAAACCGCCCTTCGTGATTTCAAAGCCCAGCTGGAGGAGGACCCTATTGTCCACAGGCATCTTTCATCTCTGTATGATACCCT
TCTGGAGCAGAACCTCTGCAGGTTGATTGAGCCCTACTCGAGGGTGGAGATTGAGCATGTCGCGCAGATGATTGAATTGCCAGTTGACCATGTCGAGAAG
AAGTTGTCACAGATGATCCTTGACAAGAAATTTGCTGGTACTCTGGATCAAGGTGCTGGTTGCCTCATTATCTTTGAGGAGCAGAAAACCGAGGCCATCT
TCCCGGCAACACTCGAAACAATTTCAAACGTTGGGAAGGTTGTGGACAGTCTTTACATGAGGTCGGCGAAGATCATGGCTTGAATACTGGTGCTCACATG
ATAGTTTATCTGTTGGATATGGTTTCATCTTGTTACACAGGTCTGTTAATGTCTTTCAAGACATTTAATCCTGCCAGTTTGACACTTTAATCTGCATGTT
GGGTTATTTAGTTAAAAAATCTACCCTTGCTCACAAACAGGATAGTTGGTTATTTCTGTATGATTGAAGTGTACCGTGAAAACTAGATGGTTTAAGATGA
ACCATGTTATGCCGCCGCGACATTCTTTTGTGATAATTTTCCATTAGCTTTTTATTTTGCCTGTGTATGGCATATATATGCTGAATATACCATGCTGAAA
AAAAAAA
page-top