Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23169  (registered. 2007)
Contig Information
Length 2329 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 5
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38153 [Oryza sativa Indica Group]
Score 3200
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23169
AACAGGGTAATTAAGTACGAGTACAACTCTTTTTTCAGAAAGAAAAACGGTCCATGTAATCTTTGTATACCCACATGCGGGAATCAATTTCTTCTTGATC
TCTACCAACCAAAATATCACACCAATGAAGCGGGGCCACCTCAGGTCATCTTGCTCTGGATTTGCCTGTGAACATGCACGAGGAACTCCACATAGGAAAG
GCCACCAGGTGTTTTGTCCTCGACCAGCAGCGAACGGAAGAAATCCCCAGATGGGTCGCCCTTTCGGCAGAGTCTCAGTCTCAAGTAAGAGCATCTCTGT
CGCCTTATTTCGTTCACAACTTCATTCACTTTCCTGGACAATGCATTATCAAATTGCTCCAATGCCAACAGATTTGGTGCACCAGCCAAAGATGAGAAAC
CAAATATTTGCTCCAGGGTGGCAGGGTTCACCGCATTTCCAACATAAATAAAACCATCCTCGCCATTTTCCAATAAATAAATCCCATCATCCTGTATATT
CTCACTATTGAGAGTAAGGGGATTTGGAATAAGGGAATCCTCATCATCCCTTGATGTAAGATCATGGAGAGCAATCATCCTAGGAAACACCAATGGAATG
GCTAATAACACAGAAACTGAGGAGACAACAGAGACCCAATAGGACCGATCGTCTACTCTCCCATCATTCCTCAGTCCTATGCTTTTAATCAAGGCCAGAG
TATACAAAGGCAGAAGTTTTAAAGCCTCCGGAAGAATTAACTGTCCAGAAGAACTTACAGATGCACAATGTTTTCGGTAGGACTGGAGAATATTGATGCA
GGTACTTATCACCTGGTCCCTAACTTGGGACAGAGAACTTGATGGAATGCCATTTGCAGCTTGCTTAACAACATAAGTAAACTGTGCTTCCTGATCAGCA
TATCGGAAAAGATTGTTGAGTGTGCTTGTGCATGGAAGTGAAATATTTATGACCCTTATCCTTCTTTGCCCATATACCGTGGTGTAAAGAAGTGCGCACT
GAAAACCACATTCTGTGTTCTCCTGAAACTTATCATCATGCTTGAAGGTAACCATTATGGTTTTGTCGGAGTCAATCGCAGGCAAATCAATATCAGTAGG
AACACGCTTGCAGAAGTTGCCAGAATAGTCTTGAACTTGAAGGCCCTGACTGCACCTGACACGCATGACAGCCTCAAATCCCTGGGGTTTAGTGATATTC
CATCTGAGATCATTGAAGAGTTTGGCTGGATCAGAAACAGCAGAAAATGGGAAGTAGTAGTAAACCCTGCCACCAGTGGTACTGGGAACAACTGATATCG
AAGCAATATCTGTGTATGACTGTGTGGCAAGGAACACATCCACACAAACTTGATACTCAGCAAATTCTAGTGCCATTGTCTTGAGTGTCTTATCAACAGG
CTGCAGGAGCTTATGTGCTTCCTTATCTCCAGTCGAAATATTAGATCTAGCATCAGTTTCCCTTGCAGATAATGAGCCAGTCCCGACTGATGGTAGCACT
GACTGAAACACAAGCAACTTTCCACCAGTGGGCTTCATAGCTAAGAAACCTGCCTTCATAGCTGCCCCAAATGCTGAATCAGCAACCCTATTGTTCTCAA
ACATGCTGGGGATGCTCTCCAGAAGTTGCTCCAAACTATCACGGCACTCGGAAACTGGGAGAATTAAGTCCATCTGAAGTGGAGTATACACATCTTGGAC
GTCGGGAACGATAAACATCAAAGGCTGTTGTCGAGCATTTTTCAGACTATAGAAGTGAATAGTTGAATCAAATGTCGCAATTCCAACCATCGTTCGGGGA
CCTTCAGGAAGATCAGAAAGAACCTGGGATATTGCACTGCAAGACGCAGCAGTTACACCAGTCTGTACGGCATTCATGGAGACATCAACAAGGAAGAAAT
ACACAGCTGGCATTGGTTCCCGGACCAGAAATTCCTTGGTGGCAATGAACTCAACTGTTCCTCTGCATAACTCAGGCCTATCATCAGCATCACGTCGCCT
ACCATCAGGCCCTAAGTTGCACAAGTACTCCCTCGGAGTATCATTGCTAAATCCACATAAGTTACAGATGAAAATTTTCCCTTGATCAACGAATCTCATG
AAAGGATTTATGTATGCTTTGCAGCGAGAACACCTGACAGGGCCCATCTCTCCAAAATCCACGAGCTGGATAGCCTCCTCGGAAGGATGAGGAAGAGCAA
AAGGTTGCACCATTAAAGCCAATGGCATTGCTGATGTTGTCAGGAGATCACCTGTACATGGTATCTGATTCAAGGTGCACCGCATCAAACGGGGACTGCA
GTTGCCGGTGTCCTTCACAATAAACTCAC
page-top