Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23163  (registered. 2007)
Contig Information
Length 907 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit UBC13B/UBC36 (UBIQUITIN-CONJUGATING ENZYME 36); ubiquitin-protein ligase [Arabidopsis thaliana] >gi|75334547|sp|Q9FZ48|UBC36_ARATH RecName: Full=Ubiquitin carrier protein E2 36 >gi|9802775|gb|AAF99844.1|AC051629_11 Putative ubiquitin-conjugating enzyme E2 [Arabidopsis thaliana] >gi|15450413|gb|AAK96500.1| At1g16890/F17F16.16 [Arabidopsis thaliana] >gi|16974499|gb|AAL31253.1| At1g16890/F17F16.16 [Arabidopsis thaliana] >gi|21555312|gb|AAM63831.1| E2, ubiquitin-conjugating enzyme, putative [Arabidopsis thaliana] >gi|66354480|gb|AAY44875.1| ubiquitinating enzyme [Arabidopsis thaliana]
Score 785
Evalue 1.1669e-81
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23163
CTCGTCGCCCATCCATCCTCCCTCCCCCCGACCGATTTTGACGACTCCTTTGACCTCTCGCGCTGTCCCTCCCCGCCCCGCCTGCGTCGCCGCGCCGAGC
TCCAGGCGCCCCCCCTCCGGTCGGATTCCATGGCCAACAGCAACCTCCCCCGCCGGATCATCAAGGAGACGCAGCGGCTGCTCAGCGAGCCAGCGCCCGG
GATCAGCGCCTCGCCGTCGGAGGAGAACATGCGCTACTTCAATGTCATGGTCCTTGGCCCCGCGCAGTCGCCCTACGAAGGTGGAGTCTTCAAGCTTGAA
CTTTTCTTACCCGAGGAATATCCGATGGCTGCTCCTAAAGTTAGGTTTCTCACAAAAATATACCATCCCAACATTGACAAGCTTGGTAGAATATGCCTCG
ACATCCTAAAGGACAAGTGGAGTCCAGCTCTTCAGATACGCACTGTTCTTTTGAGCATTCAGGCACTGCTGAGCGCCCCAAACCCAGATGATCCTCTCTC
AGAAAACGTCGCAAAACACTGGAAATCCAATGAAGCTGAAGCTGTTGAGACAGCGAAGGAATGGACTCGTATGTATGCCAGTGGCGCATGACAAGCTAAC
GCTGTTATGGATGTAATAACACCGTGTCATAGTTGGGCCTAATCGAAAACCATTTGCTTGATAAAAACACACTTGAAATGATTTGCGATGGACGAATGTA
TCCAGAGCGGCATCATTTCTAGTTGGTGGTTGTATTTGTGGTGCGTGTTCTGGCACGCTTCATAACTTGCTGCTTATAGAACACGCTCTGTTTCTCGTTC
ATCTTCAATTGTTTCTCCAATTAAAAGTATCTGTTGTGATCCGAGTATGTAAGCTCTCCAAATGATAATAGTGGCTCTCTGTTTGTATTTCTCCCCCAAA
AAAAAAA
page-top