Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11831  (registered. 2012)
Contig Information
Length 746 bp
Clones alternative view 112 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_r Root 5
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 12
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 18
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 15
WH_XE Seedling, infected with leaf rust 14
WH_XF Seedling, infected with leaf rust 9
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig11831
TTGGTGTCATGTCGATTGGTTTTATGCTGCCTAACCCAGATGATGCGGTCATATGGAGGGGTCCTCGCAAGAACCCTCGTGCCGAATTCGGCACGAGGAT
CCACCTCTGCTCTGCTCAGCTCTACTGCTTCCCCTCCATCCACCGATCGAGTGAAAAGCTCTCCGTCCGCCGGAACATCGACGACCATGGCGGGCACGGC
CAACTGCATCGACATCATCCTCGCCATCATCCTCCCGCCCCTCGGCGTCTTCCTCAAGTTCGGCTGCGGGCACGAGTTCTGGATCTGCCTCCTGCTCACC
TTCCTCGGGTACATCCCGGGGATCATCTACGCCATCTACGCCATCACCAAGTAAATCAAGGCAGCCGCCCCGAGTGTTCCGGCGGAATAGTAGTATATTT
CCATGATGATCTCGCCTGTCTATTCCTAGCGTGCTCGGGTTATTGCTTGTGTGGGTTCTTTGAATTCTTTTCCGTGTACGTTGACGATGCGAATTTCTCT
GTGGTTTCCATGGACCGTGTGAAGAGATTTCAGCTTCTTTATATGTACTATGTATATGCACTAGTATCATGTATGGGAGTTTATGCATACAGTACTTATT
GTTGAAGTTAGATTACCGCCTCCCTGTTCAAGTCTGGAATCGGCAGTGATGTGTATGTAGTCGGGTTTCTCATTTGATTTTTCAGTTTTTCTTCAGTAAT
AATAATATAAATAAAGAAGCATCAGGTTCTACTGGGAAAAAAAAAA
page-top