Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23161  (registered. 2007)
Contig Information
Length 2181 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 3
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0298600 [Oryza sativa (japonica cultivar-group)] >gi|113563974|dbj|BAF14317.1| Os04g0298600 [Oryza sativa (japonica cultivar-group)]
Score 2193
Evalue 0
Total Hit Count 16
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23161
CTCGCTTTACACAGATATGAATGTTTGCAGGCCTCTTTAAACAGCTAGTGTACACTTGACAACAGATCTGATTGTTTGCAAGCCTCTTTAAACAGCTAGT
GTACACTTGACAAGAGATCTTATTGTTTGCAGGCCGGCCTCTTCAAACAATTAGTGTACACTGACCGCCCAACTCTGCCCTGAAGCTTATCAAAGAATGG
ACTGCGATATGTATATAACATTACAAGGGACAAAGGGCAGATACAGACTATTGTACAAAGAATCCTATAGACCTAACTTACCTCAAAAGGGTTGAAACTC
TACAGTGTGTGTGTGTAAACAAGATATCTAATCTGCCGATGTAATATACAGAGCATGGCGACCTACTCGCCAACATGGAGGACTTCCTGTCGCCATTTCT
TAGAAGTTCAACACTGCACAAGAAACTTTAACCGGTCATGAACCGTCATCAGAAGAGGTTTCCTGGGAAAGCTGAGGATGCTGCAATCCATTCTCAGGCA
TGTTAAGTTCAAGCAATTCCTTCAACTGTTCCCTGACGGCATCTTGCTGGAGCTTCATCTCTTCAATAACCATGGCCTCTGCTGCCTTGCAAGATTGCTC
ATCTCTGAAGGCAAGGGTCCATCTCCCATCAACAAGATACTTCTTTGTCTTGCCTTTGAATTTTTCCGGATCAAGAAAAGGAACAGTTGAAGGACGAATA
TTTAAATGCAACCACTTCACATGCTTTTCATCTATTCTTGGATCAGATCCAGCCAAGGGGGCAGTGACACGAACAATTCCACGTTGTTGTGGTAATTCTT
CTAAAAGGAGAATCCACCCAGAAGTTCCATTAGATAGAGCTAAAAAGCTGAAGTGACGTTCTTTGCCCCTTTCAAATGCTATCCGGCAAGGAATTGCATC
AACTAAGTTGACTTCAAGCCCAGGCTTGGGCACTGAACCATCGAAGCCTGCTGCAGTTGCTCGCTTATTTACAGGCAGATCGACTGGAGAGTAAATAGGC
GGCTGATCAGTGAAAGTTTCTCCAAGGCAGAAGAGTATAACTTGATGCTGTAGCACAAAACCCTTAACCATCTCATAGATTCTCTCCGCGATAGCGATAG
AAGAATCACCTCCAAATAAAGACGGCTCCAAAGGTGAAATAATAGACTTGGATCCTTTGGGTGGTGAAGATGCCTCAATTGCTTTCTTGCAATTTTTCCA
AGCTTCTCTAACGATAGGAAGAAGCAAGTCACACCAGCATCCTCCAGATTCTTCCAGCAGCTTTTCACTGCAATCCTTGTGTGAATCCTTTAGTAATTTT
AGATGAAAAGCAGTAAACTCGTCCTCTCCATGGGGCAGCAGTTGCCTAAAAAGCCAGCCACCAACTACGCGAACATCTGCTGGTATATTAGCCCTGCTGA
AAAGGGTGACTAATGCATCGAGCACCTGATATCTGTGAACTTTAGAAGTCAATTGCCGTGGATGATGACACTGTAACCCATAATTACTCTGAAGCTTCCT
TATATAAATATCAAAATCACTGCAGATGCTATCATCTGCAACACCACTACTTGATGAAAATAGCTGCCTTTCAGCTGTATCTTCACCAACCAAAGCTTGT
AATAGAAGCTTCTTATGCTGCTTTCTTTGAGGCAAAATTCCAAGTGCATCTAACATTGATTCATCAAGTTCTTTTGTCTGCAATAATGTAGCAAATAAGC
ACAAAGAACCCAAAGCTTGGGAACCATCCCCACCTGTGATATATGATAGCAAGTGTTCCCTCAGTGTGTTGCCTTGGCAGAAATCACTTGCTGATGGATG
ATCAGGCAAACACTGCAAATGTGCAGAAGACGAAGACGTTGGCTTGTCTGCATTCGATTGATCTTCCGCAGAGGTGTTGCTGACCTGGTTCTCAGATATG
CCATGATCATGCTCAGAGGTACAACCATTGGGTGTTCCTTGTTTCCTATCAGGGCAATCAGGCTGATGGAAAAGAGCAGCAGCAACAGTGCTTGCCATAT
CTTTGTCCTTAAAAATGTGAAGTATGCAGCAAAGCAAATACATGGAAGTACTCACACTTATCCATAAATCAGTGCGCTGCCTTTGCAATGATGGGAGTAC
AATCCGGAATACCAAAAGTTGCAGGATATTTTCAGTGATAAAATTTCCTAGATCAGGGATGCCAGAAGACATAACATCACT
page-top