Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11830  (registered. 2012)
Contig Information
Length 1100 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_SH - 2
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 4
Wh_RDr Root of dessiccated seed 1
Wh_VABA Shoot with ABA treatment 9
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222637610|gb|EEE67742.1|| hypothetical protein OsJ_25434 [Oryza sativa Japonica Group]
Score 422
Evalue 3.00E-116
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11830
TTTTTTTTTTCATCATACACTTTATTTATTCTGTATACTGAACTAAAGCACATGCAACTCGCATGCCTACCACAGGACGGGTATAAATATAAGAACTAAT
GTGTCCAGAACAAAAAATATAATTACACAGCGAAGCCAGGAATCCTGTACAAGAAAGCGGCAGTTCAACAGGGGCCGGGCCTTGCAGCCTAGCGTCAGCG
AACCAATTTACAGGGGTGGTTGGTTACCTAGGCTGCAAGAGCGTGCAGAAGAATCCTCGACGGAGTCTGCAAGCTCGTTTCCAGAAGATGCCTTGGACAG
AGCTTCCACAAAATTGCAGCCTTTGGTGACGTTAGTGCTTCAGAAGGACCGCGGTCTGAGAAGATCACTTTCCAGTATCGCAATAAGAACGCTTTCCCTC
CATTTAGCTTTGGTCATTTTGGCGATTGGGCTTTGGCTAGTATCACTTGGCAGATTGCACTGCTGTTTTTTGCCTGGCAAGTACTCTCTCAAACTCAGCA
CAAGCTTCTGGTGAGTCTTCTTCGCTGGGTGGCACCAACTGCCAGAACAGTGGCAGATATGCCTCCCATTCGCTCAGAATTTTAGCGCCTTTCGTGCTGC
CCGTTTTTTCAACATAGGCCTCAATCAAACCCTTGAGCTGCATCTGCCCAGCTGGAGCATTCACTCTCTGCATCTTGACAATCTCCTTGTTAACCTTCGG
GACTAGTGTATCATCTTCATCTAACATGTAGGCTAGGCCACCGGTCATTCCGGCTGCAACGTTTCTTCCAACTTTGCCGAGTACAACTACACATCCACCG
GTCATGTACTCGCAGCAATGATCTCCTGTGCCCTCAACCACTGCTTGCCCAAGAGAATTCCGAACTGCAAATCTTTCTCCTGTCTTGCCTCTCACAAATA
CTTGACCACCCGTAGCTCCATACAGACAAGTGTTCCCAACTATAGCAGCATCCTCAGGAACAAATCCTGTATCATCTACAGGAACTACAACCAGCTCTCC
ACCCGCCATACCCTTCCCCACATAATCGTTGGCCTCTCCTACTAGGCGNNNATTCATGCCAGGTGTCAGAAAACAACCAAAGGACTGTCCTGCACTTCCG
page-top