Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23144  (registered. 2007)
Contig Information
Length 1617 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic glutathione reductase [Triticum monococcum]
Score 2342
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23144
TTTTTTTTTTCAACTTCAAGGGCTTATTTGGGTTGGAAATCATGACAATACCCACGATTTCTGTACAAACTGTTCCACAGAAACTTATTTCTACCATCAA
ATACACCGTATCACCCTTTCAGGTCAAATGCCAAGCGCAGCAGGGCTCGCGAACTGAAACAAGCATCTACGTGTACACAGTTCCCTTCGCCACACCGGTA
TAATTTTGGTCCAAAACATTGCAGGGATCTTCCTTACAAGTTCGTCTTTGGCTTGGATGGCGGGCTCACGCGCCTGGTCAAGGTCCGCATCGTCACGAAC
TCTTCTGCTGCAGAAGGGTGGATCCCGACGGTGCTGTCGAAGGTCGCTTTGGTAGCTCCAGCCTTGAGCGCAACAGCAATGCCCTGCATAATTTCAGCTG
CATCTGGTCCACACATGGCTGCACCGAGTACCTTATCGGTCTCAGCATCAACCACCAGTTTCATGGTAGACTTCTCCACGCGTTTGGATATGCTGTTCTT
CATTGGGTTGAAACTTGATGTGTAAATAAGAAGATCATTCTTGGTTTCCGCCAAAGCCTCTTGTTCGCTCAGACCGACGACAGATAGTGGTGGGATGCAG
AAAACAGCACAAGGTACATCTTTATAATCAGGCTTAACTGTCTGGCCACCAAACACAGTTTTAGCGAAGCAAGTAGCCTCCATCAGAGCAACAGGTGTTA
GGTTAATCCGATTTGTTACATCACCCACGGCCCATATACTTGGAACTGATGTACGGGAGTATTCATCAACCTTGATGGCTCCTATTTGATCAACCTCAAC
ACCAACAGCTTCCAAGTTCAGCCTATTGGAGTTCGGCGCACGACCTGTAGCAAAAAGAACAACATCTGCAATGAGCTCATCCCCTTTATCTGTCACAACT
TTAATGCCATCGGCCGTTTTACTCAACTCAGTCAAATTGGTCCCCGGATGCAATCTGATTCCCCTTCCCTCAAGGTTACTTGCAACAACTGTTCTCATCT
CATCATCAAAACCTCTTAGAGGAAGCTCTTTCCTATAAAATAGATCTACTTCAGCACCCAACCCTTTCCAGATTGAAGCAAATTCAACAGCAATATATCC
GCCACCAAGAATCAAGGCGCGTTTCGGTAGCTCCTCCAAACTTAAAGCCTCATCTGAAGTAATAGCCAGCTCCTTTCCAGGAATGTTGACCAGAGTTGCC
CGGCTACCAGTTGCAATCAATATGTGCTTGGTCGTGTGCCTTTGCTTTGAACCGTCTGGTTGGGTGACTTCGACAGTATGAGCATCAACTATACTTCCTG
CCCCTTCAATCATGGTCACACCAGAACCACCAAGGATTCTCTTGTACACTCCATTTAATCTCACAATCTCTTGAGTCTTGTTTTCCAGCAACTTTTTCCA
GTTGTAGTTGATGTCCCCGTTGATCTCCCACCCGAATTGCTTGGCGTCATCGAATTCCCCCCGGAAAGATGCCCCGTAGACGAGTATCTTCTTCGGGACG
CAGCCACGTATCACGCACGTTCCGCCGTGGCCTCCCAGCCACTCGGAGCTGATGGGGTGGAACGGGAGCTCGCAGATCGCAACCTTGGCCCCGAAGCCGG
CGGCTGTGCGGGAGCCG
page-top