Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23142  (registered. 2007)
Contig Information
Length 1010 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_SHC Shoot grown with cold treatment 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit germin-like protein 1a [Hordeum vulgare subsp. vulgare]
Score 1049
Evalue 3.39079e-112
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23142
TTTTTTTTTTACGAAAATGATAATTATATATTCCGTTCAATGAAAAGAACAAACACAACAATAAAAAGCAGTACATTTCGATTCCTCGTATTGGCTCTGA
AGGCTAAACCGCGAGGCTAACTTATTCAATCTTATTACAACTGCATGCGAGCTTAGCTAGAAGCTTGAATACGTGTCTTATGCTGAACAATTATTAAATT
TCACTGGTATGCATATATCAAATTATATACTGATCATTCCAGGGCAAGCTCCCAGGGATTAAGACCCACCAGCGAACTTGGACTTGAGAAGTTCGACGAC
CCCGGCCTCTATCCTTAGCGCCTTGGTGAGCACCGGCGTGGGGATTGGCGGGTTGGAACCGAAGAGAGTGAGCGGCACGAAAACGATGCCGGGGTTCTGG
CTGTTGAAGGAGACAACCATGTAGGCTTCCGTCTTACCAACGTTGAACTGGAAGTGCATGAGCCCGCGCGGGATGAGGAACGTCTCTCCAGCACGCACCA
CCCTGGAGTAGAGCTTGTTTCCGGAGTCGAGGCTGCCGAGGATTCCAACGAGGAGCTCACCTTTCATCACCATGCCGATCTCGGTCCCACGCGGGTGGAC
GTGCGGCGGGTTGGTGCCTCCCGGCGCGAAGTCCACACGGTTCATGGACACACCCAGCGTGTTCGTACCGGGCCACTCGGCCACGTCGAGCTCCGTCACG
GCCGAGCCATTCGGGGTGGACGTGTTGCCGGCCTTGGCCAGCTTGGACGAGAAGAGGAAGTCGTCACCAGCCTCCGACATGGGCTTGCATGGATGCCCGT
TCACCGAGACTGCCCTGCCATCGAGGTCGGCAACACAGAAGTCCTGAAGAGGATCGGGGTCGGATGCCAGGACGGCCGGAGCTAGGAACAGCATGGCGAA
CAGGCCAGCCGCTAGGTTTTTAGAGTACCCCATTGCTTGCTATGCAGCAAGCTTAGCTAGCACTGGTCAGCTAGAGTTTGTTGATCAAGAGTCTTTGAGG
CACTGGTGGT
page-top