Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23134  (registered. 2007)
Contig Information
Length 802 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thioredoxin H-type 5 [Zea mays]
Score 638
Evalue 1.03876e-64
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23134
CGAGGCCTAGTCCAGCATGAACAGCTACTATTACTACTTGGAGGACTCGCGGCAGTGGTTCTGGTGGAGCGCCGGCTGGCGCAAAACTAACGATGGCAGA
CGTTATCCTGCAGTTAATATAGTTATATTAACTGAGGTCTCCTTCGACTATGTGTTCGGCAGAGAACCATTAACCGAACCCCCTCAGGATAGCTCTCCCG
GAACTGTGATCTCGATCAAAGATATGGAGGAATGGCAATCGCGTTGGGACAATTCTGCTCGATACAACAAGCTGTTGGTGTATGCGTTCTACGACAAGAA
TTCCACACTGTCCAAGGCCATGGACAAGCTGTTGGAGAAACTCGCCAAGCAGTATAAAGGCAAGGCAGACTTCTGCAAGTTGGACGTCGACAACTTCGAG
TTTTTGGCGGGGCTTTGCGGAGTGGAGGGAGCGTATCCGACGTTCGTGCTATTCAAGAAGTGCAAGCAGGTGGGCAAGGTCGTCGGCCTCAAGGACGACG
AACTCGAGCGGAGCATCGAGCGAGCGCTAAACTAGTACTCAATGTTTTTCGTGTCAAGACTTATAATATGGCCTTCATATACGCATCGGGAGTGCGAGGT
ACATGCATGTGCATGCTACAGAACTACTGTATGTAGCTGGAATAAGCATGGTACGAAACTTGTCGAGAGATGTTGAGTATCAGATGTACTACTCCATGGA
CCTATATATGCTCCTGCATGGTATATGAGCTAGAATTTTAGGAGACATAAATATTAAAAATTCATGAATAAATTTAGCATTTATAACTAATCAAAAAAAA
AA
page-top