Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11828  (registered. 2012)
Contig Information
Length 1245 bp
Clones alternative view 90 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_SH - 2
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 13
Wh_KMV Shoot grown with continuous light after cold treatment 11
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 11
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115478593|ref|NP_001062890.1|| Os09g0327400 [Oryza sativa (japonica cultivar-group)]
Score 583
Evalue 2.00E-164
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11828
TCAGCAGAACATACAAGATAGCCGACCAACCCAGAGAAGGGAAATAAGAACTGAAATACTTATTTACTCATAAAACATAAAATAGTTATAAGATGTACAT
CTCATGTGAGGGCATAAGTTGAAGTACATTGGGGAATGGCACATGTTTACATTGGCAGACACATAAAAAGGTCCTTTGACAACATACTCGCCGCACTGTA
CTGTTCTCAACCCATTAGCTTCAGATAAGTTCAATTTTCTGCTCTGCCACCCAAGATTCTTTTGGACCCAGTTGTACTGTTTCAATCTTTGCATTTTCAA
CACAAACAAAATCTTTGTAGCATGCCTCCATCTGCAAATGAGGATTCCACAACACTGCATCTGACCAGTTTGTGTTTGAGATTACAATTTTGTCACCCAA
TCCATTGTCGAGGGTAAGCTCACTCGGTGCGCCAAGGTAAACACAGTCCACAAATCCTGGAAAGGTCACCTCGTCCCTTTCTTCTTTGCCCTCCAGAGGA
TTTTTAGGGTCAGGATCCTTATTGAGAGTCTTGCTACCTTTGAGACCTTTCACTGAAACACCAGCAATGGAAGCACTGAAATAAGTGTGGAGGGCTGAGG
TGAATGAGAAAGGTTTATCGTCTGTATTTATTATTTTGAGGGTCGTTGACAGGCTTGTAGAGTGCAGCACAACCTTGTATAAAGCTTGGAAACTAAAATC
CCACATTGAACGGCTGTATGAGTCGTCTTTTAGTTCCAAAGTTACAGTTGGATCTCCTTCTGTGACTTCTGAATCAGTAATAGACCAATTCACATTCCTT
GCGAATCCATGCTGCTGCATGGGGCCAGGGCCAAACTGGGGAAAACAATGTGGAATTCCACCGCTGATGGGTTTCTGGCCGTTGAACACAGCATCTGGTC
TGACAAAGAGCAGATCCTTTCCATTGGGAACCTTCCAAGACGTGACGCATGCTCCAAACAGATAAATCTCAGCCTCACTCCCGTGCGGGGATTTGAGGCT
GATCTTGGGCAGGCCGCCGTTGCCCTCGGAGACGGCCACGCCGGGAGCGTACACCTTCTGCCCCGCGCTCGCCATGGCAACCACCCCGAATCGCCTGTAG
CGACGGGCTGAAGTGGAGGAGGAGGAGGAGGCGGCGGCGAAGGGGGCGGGGACGGTGAGCGTGCAGGAAGCCGCCATTTCTGCTTGGCCTCTCGGAGAGG
CTGAGACTTCGGTGGTGCTCTGTCTGGTTTTAGAGTGTCCGGTGC
page-top