Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23117  (registered. 2007)
Contig Information
Length 652 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L36 [Triticum aestivum]
Score 540
Evalue 1.58053e-53
Total Hit Count 285
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23117
TTTTTTTTTTCTGCGAAGAAAAGGTGATGGGTATTCTCAAATAGAAACCACGCACTAAAGATAGTGCCAAAAACTCAGAATGCAATGTACTACCATGTCA
CTCCAATTGCAAATAGTGTCAAAAATTCATAGTTTGACTCTGAACTTGAAGTGCAATGTACTACATTCGTCTCCAATTGCCACAGGCTACAAACTTGGCA
TAATGTGGAAATACAGGGCAAAGCATTGAGATAAATCAACATGCAAAATCTATTTCTTCTTGTCCGTAGCACCACCACCACCAGACCTCATCTTCCTGAG
GACACTTGACATCTCCTCCCTCTTCTTCTTTGCTCTCTTGTGAGTACCAAGCTTCCTCTTGGCGACCTTGAGTGCGCGCTTGTCCTTTCCAACCTTAAGA
AGCTCAGTGATACGCTTCTCATAGGGAGCAAATCCAGCGACCTCCCTAATCAAGTTCCTGACAAACAGCACCCTCTTGGTACCTTTCCCCTTGCGGTCGG
ACGGGCGAGGCGGCAGCTCGCGCTTGGTGACGACGTGGCCCTTGTTGATGCCGACGAAGAGCCCTGACTTGGGCTGCAACGGCGCCATGGCCGGTCTCCT
GCTAACCTTGAGAATGGATGCGAGTTAAAACCCTAAGCCGCCGCCTCGTGCC
page-top