Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23098  (registered. 2007)
Contig Information
Length 1468 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit reversibly glycosylated polypeptide [Triticum aestivum]
Score 1733
Evalue 0
Total Hit Count 90
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23098
AGATTACACGGAAACATTAGCAGCCACAAGTATAACCGTAGTACTAAACCCTTGAGAAAACAACACCGTCTCTTAATAATGAAATTAAAGAAGGGGGAAA
TTAACGCGACCCTCAACGTAAACGTAAGATAGAACGGCAGCTAATGTTTTGTAGTACACAACAGCCTGAACCTGAATACCTGATGCACGCACTGAACCTA
CGAACTGAAGAAACCGGTATACGCCGCCTCACCACGCCTGCTCAGTATGCTAATGCAAAAAAGGTTCTCTCCCTCGATCTACTTCCCCTTGAGCTTACCG
TTGGCGTCGGCCTCCTTGGAGTCCTTGGAGTCCTTGGAGTTGAGCATGTCCCAGGCCTCGATCCAGGTGACCATGGCGTCGGCGAGCTTGGTGAAGTAGG
GGTCGATCTTGCCGAGCTTCTCCCTGACCTGCTGCGAGAGCGAGATGTAGCACTTCTGCACGGTGTCGCATTCCTTGGTCAGCTTCGCGGCCTGGAAGAA
GGGGATGATGTCCTCCTGCCAGAAGATGCCCTTGTACTCCTTCTTCAGGTTCACGAACGGGTTGCTGGCCTTGCTGTGCCAGATGTAGGGCAGCCCCGTC
TTGACTCCCAGCCCAAGGTGGTCGCAGATCACCTTGACGCACCAGCCGGCCCACATGTCGTCGTAGCGTCCGATGGGCTGGCCGTCGCCCATGAGGCCGA
AGTACATGGCCGGGCCGATGAGCTCGCGGTCGAAGGCGAGGTTCATGCCGCACATGGGGAAGAGGGAGCCCTTGGGGATGGTCATGACGGCGTCGACGTA
CCTGCCGTTGCGCTCCCGCGGCTTGACCAGCTGCGTGGGGGCGTCGTAGTCGGGGATGTTGAGCCAGAGGCCGTGCGACACGGCGGTGGGCACGCCCTCC
CGGAGGCTGAACGGGTAGCCGCGCACGAAGTCGGCGCCCTCCTGGTAGGGGTCGTACAGGGTGTTGAAGAAGAGCGGCGTGGAGGGGCAGAGCAGGTTCT
GGATGTGCTTGGCCAGCGCGTCAATGTCCTTCCCCGTCGGGTCCTTGGCCACGAAGCAGTCGTCGTCGATGGTGTAGACGTACTTCTTCTTGGAGACCAT
GTAGCCGAAGCAGCGGCAGGCGGAGTCCTTGAAGGAGATGCAGGAGGCCTTGGGGCCGAGGATGCGGTTGATGTCGTTGCGGTTGTAGAGCTCGTAGTCG
AAGCCCTCGGGCACCATGACGGTCCTCGTGGGGTCGCCGTCCTGCACGATGATGAGGTGGTACGGCTGGAAGAAGGGCCTCCACATCTCGAGGAAGTCCA
GGTTCCGGATCGTCGGGATGACGATGTCCAGCTCGTCCTTGAGCAGCGGCGCCATCGTCCCCGGCCCTGCCGAAAGCCTCAGATCCTCCTTCTCCCCGAT
CCGAGATGCGAGCAGAGGAAGGAGGAAGGCGTGTGTGTGTGGCTTCCGGCTCTGCCCTCGTGCCGAAT
page-top