Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23097  (registered. 2007)
Contig Information
Length 857 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 12
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit allene oxide synthase [Hordeum vulgare subsp. vulgare]
Score 811
Evalue 1.02508e-84
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23097
TTTTTTTTTTACCGTACGCCAAGAGTGAGAATCTTATTACAGGAAAGTCCGGCTTATTACACTGGGCAAGATTGCGAAAAGTAAAACACACATACACAAG
GGCACCATGCAGGATGCAGCGATGCAGCGAAGCAACCGAACAAGATGCATGCATGACTGACTCGTACTAGTAGTATATAGCGAGGCACGTACGTACGTGC
GCGCTGACGGGGACGATTGATGGCTGCTGTGAGAGAGCTGCTGCGGTACGTTGATCCGATGACCGGTGCAGGTTCTAATTTTTAAACAGCGCTCTCAGGA
CCGGACGTGGCCTTGGTGACGCCGGTGAACTCAACCTTGGTGCCGAGCAGGTCGACCCCGACGTCGGCGGTGAAGGTGTCGTACCGGAGGAACAGCTCCA
CCACCAGGAGCCTGCCCACGAGCACGACCAGGTTCTTGCCTGGGCACTGCTTGTTGTCCACGCTGGGGCTCTCGGTCTCCCGCCCGTTGGACCAGTACAC
GTACTGCAGCAGCTTCCTTCCCTCCTCCCCGACGAACCGGTCGCCGACGAACTCCCTCGCCGTGGAGCCGAACACGCGGGGGTCCCTGGTGGCGCACGGC
TGGTACCCGAACAGCATCTCCCCCTTCTTCACGGCGAACACCGCGTCGTGGCTCTCGATGTTCATGTCCGCCTTGGCGCGGCCGTACTGGAACTTGACGG
GCGGGTCCAGCCGCAGCGCCTCCCACACCGCCGACTTGGTCAGCTCCATCTTCTCCAGCGCCTCTATCGTCACCTTGCCGCCGGCGTCCGCCACGGCGGC
GCGTATCTCCGCGACGAGCTTCTGGTGGAACTTCTCTCCGGCCCCCGCGATGCGCGC
page-top