Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23092  (registered. 2007)
Contig Information
Length 1693 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 3
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09029 [Oryza sativa Indica Group]
Score 2071
Evalue 0
Total Hit Count 342
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23092
AAGCTGTTCCTAGCCTGTCGCTACAAGATATCCCTAAAAAGCCTATTCATGTACCAATAGAGGTGGGGGAGATAAACGGTGTCAAAGTCTTGCAACATGA
TCTCTTCACCAATGATGTAGTCTACTCCGAAGTTGTATTTGATATGGGTTCTATGAAGAAAGAACATCTACAACTGTTGCCTTTGTTCTGCCAATCCTTA
CTGGAGATGGGCACAAAAGACATGGACTTCGTGCAGCTTAATCAATTAATTGGAAGAAAAACTGGAGGCATATCAGTTTACCCATTAACATCTTCAATAA
AGGGAAAAGAAGATCCTCTTACTCGTATTGTCGTTCGAGGAAAGGCAATGTCAACGCGCGTAGAAGATTTGTTTCACCTGATGAACTGTCTTCTTCAAGA
TGTTCAGTTCACAGAACAACAGAGGTTCAAGCAGTTTGTTTCCCAAAGTAAAGCAAGAATGGAGAATCGATTGAGGGGTAGTGGCCACGGTATAGCAGCT
GCCAGAATGGATGCTAAGTTAAATGCAGCTGGATGGATTTCAGAACAGCTGGGTGGTGTTAGTTATCTTGAATATCTACGAGACCTGGAGACGAAGATTG
ATCAAGATTGGGACAGAATATCTGCTTCACTTGAGGAAATGAGGAAGTCTCTATTTTCTAAGGAAGGTTGCTTGATAAACATAACAAGCGACTCAAAAAA
TCTTGAAAAATCTGGTCAACATATTGCCAAATTTCTTGATGCACTGCCAAGTTCCCCATCCCTGGGAAGTGATCCATGGCTCTCTCGGCTGCCTTCTGTT
AATGAAGCCATTGTTATCCCTACACAGGTTAATTATGTTGGAAAAGCTGGAAACTTATACCAAAGTGGATACCAACTTAATGGAAGTGCCTATGTCATAT
CCAAGCACATAAGCAACACATGGTTATGGGACCGCGTTCGAGTTAGTGGTGGCGCATATGGAGGGTTCTGTGATTTTGACACTCATTCAGGGGTCTTTTC
CTATTTGTCATACCGTGATCCGAACTTGCTGAAAACACTAGAGGTCTATGATGGGACTGCAAAGTTCCTCAGAGAACTAGAGGTAGATGATGATGCTCTC
ACAAAAGCTATTATTGGAACCATAGGGGATGTTGATTCCTACCAGCTACCAGATGCTAAAGGTTACAGCAGCCTGATGCGGTATTTGTTGGGCATCACTG
AGGAGGAACGCCAGCAAAGGCGCGAAGAGATACTCGCAACCAGCGTGAAGGATTTCAAGGAGTTTGCCGATGCTGTAGAAACGATCAATGACAATGGGGT
TGTGGTGGCTGTAGCATCGCCTGACGACGTCGAGGCAGCAAACAAAGAGAAGTCATTATTTCCAGACATCAAGAAGTGCCTGTGAGGCCTCTCCATTCCC
ACGCCGGCGGGGTTGAGCCTGGACCTGCGCCGAGCAGAGGTTCTTCAGCGTTTTGCTCGACTGATGAAGAATGGTCTGGCGCTGTGACATGAGTTCGCGT
GGCGAGAGCACTCCCATTTTTAGGGGAAATAATTAGTTCAGGGTGTTGAGCGAAGCACAATAGTTAAACAGAGTTGCATTGCTGCCTTTCCCCCTCTGCA
ATCAGTGCTCAAACAAGCCGGTTGTACACCAAGTTGCTGATAGGAAATTACGAGCTGATGAGAACCTGCTCAAATTTTAGCTGAAAAAAAAAA
page-top