Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23014  (registered. 2007)
Contig Information
Length 2186 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_026823 [Oryza sativa (japonica cultivar-group)]
Score 1064
Evalue 2.40576e-147
Total Hit Count 110
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23014
GGCGGCGGCGGTGGCTACGGCGGCCAGCGCGGCGGCGACTCCGGCGGCCAGTGGAGGAACTGAGCGGCGGGGCCCTCCAGTTATCGATCTATCTACCATC
TCGTCGTCTTCGTCATCAAGTTATCTTCAGTGTCGTCGTCGTCGTGTTCCTGTGTCAGTCAGTCTTGAGTCGTGTGTGTCGTTCGGTCCTGTGGTGTTTT
TGATCGCGAGCTCGAGTGTCGCTCTGTCCGGGGTTAATTAGAGCTGGTTACGCGAGGAAGAAACAACATGTGTTATCTTTCAGTCGGTCGGTCGGTCGTG
TTCGTCGGTGATGCAGCAATCCCTTCTGTCATGGATTGGGATGTGATGTTGGAATCCTATGTTTGAACTCAGTTTAAATGGATGAAGAAAATGCAAGTGA
TAGCTGCGAAATAAAAACCTCGTGCCGAATTCGGCACGAGGGGAAACTTGGAAAGGACCCTGATGATTTATATTATTCTGCTCCCAAGGCTCATCCAGTC
AGTTCTGAGCCTCGGCGAATTAGCATTGACATTGAACAAGCTCAAGCTCTCATCTGTAAACTTGATTCTGAGAAGGGTATTGAGAATAATGTTCTATCTA
GTAGTGATGATGACAAAGCAGGCAGCGGATCACATGGTTCAATGGGCCCAATTGTAATAATACGGGGTGCATCTACTGTGAAGGGTCTTGAAGGTGTTGA
GTTGCTGGACACTCTTGTCACTTATTTGTGGCGTATCCATGGTGTGGATTATTATGGCATGTCTGAGACAAATGAGCCAAAAGGCCTAAGGCATGTGAAA
GCAGACTCAAGGACATATGATGGGCCTAGCTCAAATACAGCTGAATGGGAGGAGAAACTTGATTCATTCTGGCAAGACAGGATTCAAGGTCAGGATCCAT
TGGAAATATTGAAAGCAAAGGACAAGATCGATGCAGCTGCTAGTGAAGTGTTGGATCCACATGTCAGGAAAATAAGGGATGAGAAGTATGGATGGAAATA
TGGTTGTGGAGCTAAGGGGTGCACAAAGCTTTTCCATGCTTCTGAGTTTGTCACGAAGCATCTCAAACTCAAGCATACTGATTTTGTGGTGGAGCTGACT
TCAAAAGTGAGAGAGGATATTTATTTTGAGAACTATATGAATGATCCCAAGGCGCCTGGGGGAACACCGATCATGCAACAATCTGCTCCAAGGGAAAAGG
GCAGACAGGCGGCCACCGATTGAGAGTCGGCTGAGAGATGAACGTGGCCGTAGATTTGACAGAAATGTTGATTCATCAAAACCTGATGGATCCAGTGAAA
ACCCTGATGATCCAATGTATGATTCTTATGGTGATCCGGCTGTACATGGTGCCTTTCCTCCAGATATTCCAGCTCCTCCAATGCTGATGCCTGTGCCTGG
TGCTGGCCCACTTGGGCCGTTTATTCCCGCACCACCGGAAGTTGCAATGCGTATGTTGAGGGAGCAGGGTGGGCCACCACCTTTCGAGCCGAATGCTGGT
CCACGTCCTAGGAAAGCAGGAAGGGGTGGTGGTCCCCCAATGGGTGGTCCATCACCAATCCTTAATGCTCCACTTCCTATAATGCATGATCCACGTATGC
AAGATCCACGCATGCAAGATCCCCGTAAAATACGAAGCTATCAAGATCTCGACGCTCCTGGAGATGAAGTGACCGTTTTGGACTACCGGAGCCTGTAGGC
GTGTGCTGTATGACCTTTTAATCTTTGAAGCCGTGGACGATACAACCACCGCAACGGGACCTTGCTCATCTCCATTAGTTTTGACCGTGGCGGAGGAACA
CGGCTGCGGTGCTCCGTCCCGTGAGCTATGTTATACTGATTGGTGCTTCTAAAACCGAACCACATGAAATCAAAGCAACTGGCGCACTGAAAGCACGGTT
GTGGAGTGTGTATTTCCAACAGAAATTTTTAGCTTTTCAAAATTTCCACCATCTAGAGAGAGACAGAGTAGAGGTCTGTGCTGCCGTATCCAGAAATCCA
GACCAGATATTCCTCACCGTGTATGCAATCTGTAATTTATACTCCCTCCGTTCCGAAATAGATGACTCAACTTTGTACTAACTTTAGTAAAAAATTAGTA
TAAAATTGGGTCATCTATTTTGGAACAGAGGGAGTATACAGGAAAACGGTTGGTAGATGAACCCTGATTGGTCAAAACTGCTCACA
page-top