Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23012  (registered. 2007)
Contig Information
Length 1075 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_RDr Root of dessiccated seed 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0157K09-H0214G12.11 [Oryza sativa (indica cultivar-group)] >gi|218195195|gb|EEC77622.1| hypothetical protein OsI_16606 [Oryza sativa Indica Group]
Score 711
Evalue 5.81725e-73
Total Hit Count 131
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23012
GGACTCTCACAAGAAGACGCCCAGAGGAGAGGAGAGGATGCTGCTGAGGAGCTCCTCCACGCCATTCCTGCACGCCTTCCTCTCCACCACCTCCTCCTCC
CCTACGCCCCCCTCCTCCCTCCAGCTCCGGCGAGCCTTCTCCGACGGCCACCTCCCTTCGCTCAACCCCTCCTCCTCCGGCGACGACGACAGCAAGACCA
CCGGCCTCTACACCGAGCTCTCCTTCTCCATCTACAACACCTTCAGCAAGGCCAAGCTGGAGCCCCACCAGGAGCAGGAGATGGAGGAGGAGCAGGAGCA
GCAGGCGGCGCAGCCGGAGCTGCCGCTGTTCCTGGCGAGGGGCATGGGGATCGACCGCCTCGCCTCCGGCCTCTTCACCGCCGGCATGGGCTCCGAGGCT
GCCCTGGCTAGGATGGCCAGCGGGGTGGACCAGAAGGCCGTGCTGGCGCTGGACGCCCAGTACAAGGAGATGGTGGACGAGCAGCCCGGCAACGCCCTGT
TCCTGCGCAACTACGCGCAGTTCCTGCACGAGGTGAAGTGCGACTCGAGAAGGGCGGAGGAGTACTACTCGCGCGCGATGCTGGCGGACCCGACCGACGG
CGAGATCATGTCGCAGTACGCCAAGCTGGTGTGGGCGGTGCACCGCGACCACGAGAGGTCCCTCACCTACTTCCAGAAGTCGGTGCAGGCGGCCCCGCGG
GACAGCCACGTCCTCGCGGCGTACGCCAGCTTCCTGTGGGAGCAGGACGAGGATGAGGACGACAATGACGACGGCGGTGTTGGGGGAGGCGAGCAGGGAT
CACCCGGGCGTGCTGCGCAGCCGAGGCAGCTGGCTTCCACGGCCGTTTGACTACCAGGGGTGGCCAAGATGGGCTTAACGATGTGCGTGCTGATGAGTGA
TGACCATGCTTGTATGATGTTTCTGTATAATCTGCAAAATGTTTGGACGATCGAGGTGCTGCTACGGAATAAAGAACGTAACTGTTGAGGCGATGGAAGG
CTGTACCTGTAAACACTGGTGATTCCGTCTGCCGATGCAAAGTTGCTATACTATGTTTATTGGCTAAAAAAAAAA
page-top