Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22985  (registered. 2007)
Contig Information
Length 928 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0127800 [Oryza sativa (japonica cultivar-group)] >gi|77548487|gb|ABA91284.1| FHA domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644335|dbj|BAF27476.1| Os11g0127800 [Oryza sativa (japonica cultivar-group)] >gi|125576048|gb|EAZ17270.1| hypothetical protein OsJ_031479 [Oryza sativa (japonica cultivar-group)] >gi|215678943|dbj|BAG96373.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215679050|dbj|BAG96480.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737414|dbj|BAG96544.1| unnamed protein product [Oryza sativa Japonica Group]
Score 540
Evalue 3.10204e-53
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22985
ACGAGGCCTCGTGCCGAGAATTTTATCCGCTTAACTGCTGCCCGTCGCAAATGGAGGCAGCGGCAGCAGCGGCTAGTTCCTCTGTCCTGCTGTCGTTTTC
CAGCCCGAGGAGATCAACGGCGGCTACCTTCCTCCGCCTCTCCACGGCGTCGCCTCGCATCACGTGCTCCGCCACACAGCAGCTTCCCCTCGCTGCACCA
TGGTTGTCAGCCGCCGAAAAGAGCAGCACTAGAAGAAGAAGCAGCATCCTGTCGTTAAGGTGCTCCTCGGCCGCCACCGGCAGCCCGTCGGCCGTTGTCT
CTTCAGAACGATGGATTCTTGAGCCCGCAGGGGACGGCGACTGGAAACACATCGGCTACCGCGTCGCCCGCCCCGGCGCCATCGAGATCGCATCCGAAGC
GATGACCGTGGGACGAGTTCCGGAGAACGCCGACGTCGTCATCCCCGTCGCAACAGTTTCTGGGGTGCACGCTCGGCTGGAGAAGAAGGACGGGAACCTG
GTGGTCACGGACATGGACAGCACCAACGGCACCTACGTCAACGAGAGGAAGCTGGTACCGGGATTCCCGGTCGCCGTCCAACCCGGGAGCCTCCTCATCT
TCGGTGACATCCACTTGGCAATGTTTCGGGTGAGGAAGACAATCGTCGATGTGGCAGCCGAGGCCACCAAAGATGACCAGCAGGAAGCTGAGACTGTGCT
GGCAAGTGCAGTTCAAGAAACAAGCTAGTCTACCTTACCTTTCAAAATAAGAGTGCAAAATAGTGCATCATGGTAATATGCAGTCCCCGTCTCAGGATCA
ACGAAATATGTAGCTAGGCAGAAATAGCATGTACGAGTAAAGAGTAACTTGCAACATGTCATGCTCAAGGAACAGGTCATTCAAACAAACACACGCTAAA
TTTCACGCCAAAGCCTGATCTGACCCAT
page-top