Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22978  (registered. 2007)
Contig Information
Length 974 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_SHC Shoot grown with cold treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0569500 [Oryza sativa (japonica cultivar-group)] >gi|4105683|gb|AAD02495.1| unknown [Oryza sativa] >gi|4105692|gb|AAD02496.1| embryo-specific protein [Oryza sativa subsp. indica] >gi|113579915|dbj|BAF18278.1| Os05g0569500 [Oryza sativa (japonica cultivar-group)] >gi|125595270|gb|EAZ35329.1| hypothetical protein OsJ_018812 [Oryza sativa (japonica cultivar-group)]
Score 1060
Evalue 1.69061e-113
Total Hit Count 100
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22978
AAAGAGTTTATTGATTCATTTGATCCCTTCTAACTCTACATCCTCGGTTCCTCGCTCCGCCACTGCCTATGACTGTTATTCGGAAGTCCATCATTCTTCG
AACACTCGCTCCATTTCCAAGAGGAAAAACAAAGGGGTGGGAGACATTTTATTAACTACCCTATCTCCAGCTATCACACACCCATCTCTCGGACACGTAC
GAGAACACGCCAAGGGCAGATCAGGTGAAAATCCTGGCTCCAGTATTGGCAGCCGGAAGATCGACCTCGCGGATCTCCGTCTTCAAGCCCTTCCCAGCAG
CGTTGGCCAGCGGGTGGATGCCGTGCGCCGGCCCGCTCATGTACGCCCGGTTCTCCCTCTCCTTCTGGAACGACACGCTGAACTTCTTCTCCACACAGTC
GGCGAGGTCCTGCCGGAGCTGGCCCTCGCGGGTGAGCGCCATCATGATCTGCGGGAGGCCGAGCGGGAGGGCGTCGCCGCGGTCGACCTGCCAGAAGTGG
ACGGTCTTGCCGTACGTCTTTGCCACCTGCTCGAGGTCGCGGCGCTCGACGACGCCGGGGACGCCGGGCATAAAGAGCATGCCGCCCTTGACCTCGAACT
CGTGAGTGTGCCACAGCGGCTTCTCCTCGTCGGGCAGCGTGAGGAACAGCTCCTCGGTGACGATGTACTCGACGCCGATGAGGCGCGCACCGGCGTCGGG
CCCGTCAAAGACGAGGCACTGCCGCACGTCCTCGTTGAGGTGCGCGCAGAAGTGGTGCGCCTCCACCTGTCGCGTCATGTCGTCCCCGTAGAAATGGAAG
GCGCAGAGGTGCTGGTGGATCTGGTTGATCGGGGCGAACCCCTGGATGGCGCCCGTCGCCGCCTCCAGGAGCGCCGTGCCCGTCTCCGTCGGCTTCCCCG
GCACGTCCACGTCGTGGCACGACGCCGCCATCTTTGATCCTGTGCAAGTTTTGTGTGTTGGGGTACTGGTGGGC
page-top