Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22975  (registered. 2007)
Contig Information
Length 845 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 5
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Postia placenta Mad-698-R]
Score 82
Evalue 3.40061
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22975
GCTCCTGCCTTCGCGGCCTCGCCCTCGCATCACTCTAAACCGCCATCGGGTGCGCCTCCTCGGCGGCGGAAGGCGAACAGCGAGGAACCCTAACCCTAAC
AACCAGTAGATCCGATCTGCAAGGCCTGCGACGATGGCGGCTTCCCTTCGCGCGGCGGCGACGAGGATCCTCCGTCCGGCGGGCCAGGGGCTTCGCCGGC
TCGTCCACACCCAGGAGCATTCTGGATCCACCCGTGCCTTGGAGGAAGGGTACCCTGCAGCGCAAATCCAGCAGCAGAAGGAGGAGCTGTACGATCTCAT
CGCCGACGCCTATGCCAATTCCGCGTCTTCCCCTGCTGACAGATATGTGCTCAAGGTTCTCTCCACACAAATCAAGCCGAGACCACGTGACCCTCAGTGG
TGTGAGATAATTACAATCAAGAAGGCGGGCAACTGGGCTCTGGGAGGTTTTTGTTTTGTTGGTGGTAGCATAATTCTTGCTGGCCTTGCTCAGGGTGTGC
GTAAGCGAGCGGAGCTCGAGATGCCCAAGCCTGTGGAGCCATACAGAATCAAAAGGAAACTGCAGAAGCAAGTCGAGTGACGACGAAATGCATCTTGTTT
GATGGAGAAGCAAGGCCGATATTAGTTCTTCTCCAACGCACTCTTATTCAGGCCTCTTAAACTATGGCAAATTGTTCGGGTTTATCATTTCTGTAAACTA
TATATATGTCTATGATCTGCCACCTATGACTGAGTAGTACTATTACTGGATGATCTTTGATCGCATTGTAAGATATTTGTGATGTTGCTGACATCGTATG
TTGTCCTTTCTGTTTGAGTAAATTGTGTGAAAATCAAAAAAAAAA
page-top