Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22967  (registered. 2007)
Contig Information
Length 2713 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27446 [Oryza sativa Indica Group]
Score 2433
Evalue 0
Total Hit Count 345
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22967
ATCAACGACAACATCCTTCACTAGCCAGTCCTCTGTTGCTCCTAGTCGGAATCTTCTTTCAGGTCGCTTTCCTATGTTAGAGGCTCTGTGGAAGACAATA
AGTGAAACTGATCAAGCTGAAGCACTTCCAGCTAAGGATTCTGCTCTGGTGACATCTGCTGCTGGTGAGATCATACCAGTTCTTGCCAGTTCTCCTGTTC
CTTCTGCATTAAAAACACCGAAGGAGGAGGACATTAGTTCAGCAGTTCCACTAGATATAGAAACAGTAGAGGCTAAAGTGCCCACTGCAGATGCCACTGG
ATTATCGATGGAGATTCAGGAATCATCAGAAACTTCCCATGCTTCTACAGAACCTCAGGGAACCCAAGAACATTCTGGCAGTTTTGTTACTCCTTTGCCA
GCTGACAATTCTTCAGTTGGTATCAGTTTGGCTCAATGTTCAGAAACTCGCAGTCCAAGCTCCTCTACTATTGACGGAAGCCAGTCACAGTTTTCATCTT
TGAATGCCCCTACTTCACAGTATGTTCTTCCAAAATTGGTTGTGACTAATGTCGATCTGACCGATGAGGCTAAAGATCTCCTTCAAAAAGAAGCATTTCT
GCGTATTCTTGAGAGAGATAAGCAAGTAGAGGTCTGGTGGTTCGAAAGCTCGTCTTCCGTTGCTTTCTCACCTGAGTGTTGAGTTTCCTTTGGAGTTGGA
CCCGTGGGAGCTTCTCAAAAAGCATGTACTATCTGACTATGTAAATAAGGAGGGACACGAGTTGACACTAGGCATCCTGAACAGGTTATATCGCGAGGCA
GAACAGGATCAGGACTTCCTTTCATCTAGAACTGCAACATCAGTTTATGAATCATTTGTTCTGACAATAGCTGAAAATCTTCGTGATATGTTTCCGGCTT
CAGATAGATCACTTGGCAAATTGCTTTGTGAGATGCCATACCTACCAGAAGGTGTATTAAAATTGCTAGAGGGTTTATGTTCTCCTGGAAATAATGAAAA
GCAGGACAAGGATCTTCAGAGTGGTGACAGGGTAACTCAAGGTCTAAGTGCTGTCTGGAACCTTATCATGTTAAGACCTCCAAATCGGGACAGATGTCTG
GACATTGCTTTGCAGAGTTCAATCAATCGTCTAGATGAGGTCCGCATGAAGGCAATACGTTTGGTAGCAAATAAACTATTTCCCATGGCAAGCATTTCCA
AAAGGATTGAAGATTTTGCAAATGAAAAACTTAATTCAGTCCTAGAAGTGATTCCAGCGGCTGAATCTGCGTCAGCTGCTGAGATGGCCACACCCGAGGT
TCACCAGGATGGTGGTTTAGAAAATTTATCCTCGGTAGCAGATGCTCTAACTTTGATGTCGCTGTATTTTGCTCTGTGTACCAAGAAGCACTCCCTTCTC
CGACGTGTATTTGAAATATATGGCAGTCTTCCACAGGCTGCCAAACAGGCAGTTCACAGACAAGTACCCATTCTGATTCGCACGATACGTTCCTCTCCTG
ACCTTCTTGGTATCATCTCAGATCCACCAGCTGACTGTCGGGGCCTACTCATGCAGGTTTTACAGACTCTCACTGATGGTGCAGTGCCATCTCAAGATCT
GATTTCTTCCATAAAGAACTTATATTCAAAAACTAAGGATACTGAGTTCCTTTTCCCAGTCATGGCTCATCTGCCAAAAGATGAGATTCTGTCTGTGTTT
CCCAATATTGTTAATCTTCCGGTGGATAAGTTTCAAGTTGCCCTTTCTCGAATCCTGCAGGGATCACCACAACATGGCCCTATTCTTGACCCATCAGAAA
TTTTGATTGCGATTCATGTAATAGATCCTGAAAAAGAAGGAATACCACTGAAAAAGGTTATGGATGCATGTGCTGCCTGCTTCGAGCAGAGGACAACATT
CACTCAGCAAGTTTTGGCAAAAGCACTAAACCAACTGGTTGAACAGATTCCCCTACCTTTGCTGTTCATGCGAACTGTTATGCAAGCGATAAGTGCATTT
CCTGCCTTGGTGGATTTTGTGATGGAGATCATGTCACGCCTTGTTAACAAGCAGATATGGAAATATCCGAAGTTATGGGTAGGATTCCTGAAGTGTGCTA
TCCTGATAAAACCTCAGTCCTATGGTGTGTTACTGCAGTTACCAGCTCCACAACTCGAAAATGCCCTGAATAAGAACCCTCTACTGAAGGCGCCCTTGGT
CGAGCATGCCAGCCAGCCAAACGTGCGATCAACTCTCCCGAGATCTATCTTGGTGGTTCTGGGTCTCGCCGAAGATCAACAGCAGCAGCCCGCACCTGAG
GCACAGAGCAGCCAGAACCAGGCCGCGGAGACCAGCAGCTCCGCCGCAGAGGCCACGACGGAAGTAACTCAGGAATCCTCCGCCGCCAGTTGACATTTCC
CCCGCAGCAGTGCTGGCCTTCTCTGTATTTGCTGGAACAGAATGGAGGCATTTGGCAGGCGACGAAGTGCTGCCTGCATTAATGTAGTACCGGGAAAGAT
GGCATGGCAAGACCATGTGGCGAAGCAGTGTTCAGCTGCTGCGCGATTTGTATAAAACATTTATTACGCTAAGAATTTGAAAATAGTGGTAGGAGAAAGT
TGTTGCTGAGCCCTGCTGTTCTTTTGTTTTGGTAACCTGTAATTCCAGTCCACTAAAGTGGTATGTAGAACATTAAACAAGGCTTGTTGTCAAAAAAGTT
CTGAAAAAAAAAA
page-top