Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22966  (registered. 2007)
Contig Information
Length 1029 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit endo-1,4-beta-glucanase Cel1 [Hordeum vulgare subsp. vulgare]
Score 1138
Evalue 1.66286e-122
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22966
TTTTTTTTTTGTTTATATGAAGGTCACACATTCTTTACTGTGACGAATAAGTCACTCCTATAAAACAAAACGACTTACAAAGGTACCATTTCTACAAAAA
GAACTTCACACGTGAACTTGGAATTTGAAGAACAACAAGGACCTCAAAAATTAGTTTCACAAATCGCACACAACTTCCAGTCCATGGTTCACAGATGATT
TATACTGATCCGTCATACCGATACAGAAGTAGAAACTCTGTAAGCTTATGTTGTCTGCTTTCTGTTCGTGGCCTTCGCTGTATATACCAAACAACCATCT
GTTGCTCCCTCCATTTGATGCTTATGAAATGTTCAGGGATCTGACTCTTCATGGTTTCCAAGCTGATGGTGGTGGTGGGGGTGTCGGGAACATTGGGGGA
ACTGCTGAGAAGATGGTGTTCTTATCAATTGAATATCTGCCGGTATCGATGTCAGCTAGAGAAATCAATGCTGCAACCAGGCCAGCATTTGCTGCAAGAG
TAGGCTCTGTGTAATTGTAATTTGTGCGGATATCCTTGAAGCCATCATGCTTGTCAGGGCCAGCAACCATTGCTCCAACGAGGATATTAGGGTTTGCTTT
CTTAGACTCTCTCCATTTGAAACCTCCTTTGCATCCGTACTTGACACCGTTATGAGGGATTGATGCCCCTCTGTGATGAACACGCTTGGGGTACTTCTTT
CCAAAACCCACGACGTAGCTCATCTTTTGTGGGTTCTTGCCTAGAATGTAATCAAGCTGTGACTTTGCAAACTTGCGGAGGACATCTGTGGTATAGAAAT
TAGGTCCACAATACCACCCTGGTGTATCCGCAGTGTCCAGATAATCAGCATACAAAGAGGCAAGGAAAGCTGCATTGACGACGTACTGAAGCGGTTGAGG
CCCTCCATGGTTGAGTTGTATCAATCCTCCTTTAGTGAAGTTGAATGAATTGAATACTGGTAAATATGAGCACATGACATTGTCAGTTTGGTTGTGGAAT
GTCCTTAATATTTCTTCATAAGGATACCC
page-top