Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22957  (registered. 2007)
Contig Information
Length 503 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_04085 [Oryza sativa Indica Group]
Score 95
Evalue 0.0311352
Total Hit Count 39
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22957
TTTTTTTTTTAAGTCATAACTGACAGCAATCTCCTCCTCATACTTTATTAAACAAGGTTTCACATCACAACAACATGCTTGGAATGAAAAGTTCTGAAAC
ATATATATAGAGACACGAAAAGCAGCGGAATTATAGATGTATGCAGATTGCAGATCCAGTAGAATGTATCATGTATGCTCACGTCACGGACACATTTCTA
GGGAGGAGAGCGACCCCCACAGGCCGCCGCAGGCGAGTCCGTCAGGGATTAACGGCGGCGGCGAGCGGGGCTTCCGCCGTCAGGCGCTCGCAGCACTCGG
GGCGGTAGGAGCAGCACGCGGGAACTCCGGGCACAGCCCTGCCCTGCACCTTCGCCGACGCGGCCATCATCAAGAATAGGCAGACCTGCACGAGGAGGAA
AACCAGCAAGGCACGGAGGTGACCCATCGCCATGGTCTCTCGCGGTTGTTGTTTTGCTAGCACAAACAGTAACACGAGAAGGAGAGGGAGCACTAGTATT
TCC
page-top