Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22954  (registered. 2007)
Contig Information
Length 800 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0241200 [Oryza sativa (japonica cultivar-group)] >gi|108707099|gb|ABF94894.1| NHP2-like protein 1, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547985|dbj|BAF11428.1| Os03g0241200 [Oryza sativa (japonica cultivar-group)] >gi|125543066|gb|EAY89205.1| hypothetical protein OsI_10701 [Oryza sativa Indica Group] >gi|125585560|gb|EAZ26224.1| hypothetical protein OsJ_009707 [Oryza sativa (japonica cultivar-group)]
Score 540
Evalue 2.41166e-53
Total Hit Count 410
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22954
AGCACAAAGATAATCCACCACATGAGCAATCGCACACAAGCAGCTAGTTCCCAATTCTCAAACTCATAAAACCATTACCCGTTACAACATTTGTTGAGTC
TAGGGAGAAATTCAACTGCCATGACACATGTGTCTTATGGATTACACAAGTCACAAATATAAGATGACGACATAATGGCAGCACGATTTAACATAACAGT
CTTGCAAAATATAGCTGAAAAAACACAAAGACCTAGTAGACAAGACACCATCACCAGTCCAAGCCTCTGAAGAACTGTGTCGCAGAGGCCCATCACACTG
AAAGGTCTTGATAAATCATATGAGAAGCTTCTCGATAGCATCCTTAAGACTCTGAATTGGCTGTTTCAGCTGGCTTCCCTCGTTGCTGGTCACTGAACAA
GCAATGACCGGCCTAGTCACTCCACAAGCACGCCCAAGGGCTTGCTTTGAAGGGACAAAGACATATGGCACATTCTTGTCCTCCGCGAGCAACGGGAGGT
GGAGGAGGATTTCGAGCGGCTCCGTGTCAGCTGCCATCACCACGAACTCCGATATTCCCCTGTTGAGAGTCTTGGTCGCTTCGTTGGCGCCCTTCTTGAG
CTGCTTGTAGTTGGCGGCCTGCTGGACGAGGTCGAGGATCGTTATCGTCAGCTGCGAGTCCGCCAGCGGGTAGGCCTTGGGGTTGACCGTCTCCTGACTC
ATTTTCCCGACGGGTTGGTCGGCTTGGAGGCGCGGGAGGAGGGGGAGGAGGAGGCGGCCGCCGCGGGTGGGGGAGCTTGGCGCTAGGGCTTTCGGGGGCG
page-top