Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22938  (registered. 2007)
Contig Information
Length 1348 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Serpin-Z7; AltName: Full=HorvuZ7; AltName: Full=BSZ7 >gi|1197577|emb|CAA64599.1| serpin [Hordeum vulgare subsp. vulgare]
Score 1563
Evalue 1.29386e-171
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22938
TTTTTTTTTTCTGAAAATCAGAACCATTTATTGGATTGATTGCACAAGCAACCTTATTGGATGTTGAAACCCTTCCCTTACATGTAATAGTTGAGGCAAC
TGCCAACACACATATTTAGGGCAAACATATTATGAAGACACGAGGGGATTGGCCACATGACCGATGAAGAGAACCACACCAGTGACGTCTTCTCGGATAA
GGAAGAGGAAAGGGTGATCTGCAACGAAGTCCATCACAATGGGCATCTGTTGTTGTTCGATCGCTACACTAGTTGCTGCTGCAGCCTCAGTTCCTTGTTC
ATTCACTTCGACAAATGACTTGTGGAAAACAGATGAGAGGAATAGGTCCACCTGAGAATTCACCATCTCTGACAGGTTTGCCTCCCTGCTAAATGGCAAC
TGAAGACCCAAACTCTTGAGCAAATTGGTTGCTTCAAATCCAAATGATATCTTGAACTTTGGAAGCATGAACTGATCAACTACAACTTTCTCCGTTGGTA
TATGCTTCTCGATGAACTCTGATTCAGTGCTCAACCTTTTGGCCAAGGTCCAGAGATCATCACGTCTTTCAGGAAGAAGAATGTACATGGAGAATTGCCT
ATTGTCTCCACCTTTCTGATATGGAAGCTTAAGTACCTTCAAGCCGTCGGAAGATGAAATGTATTGCTTATTTGTACTGGACATGAATGGTGTTTGAACA
GTGTTCCCATTTAAAAGGTGGAACTTGTCGTATTTTGTCTTAGATTCGTCAAATTTCTCAGTCCAAAGTCCCTTGAAATAAAGGGCATTACCAAGAACCA
GTCTAGTGGTGTAGTCAATAGACCCTTCAGGGAGGATCTCTCTGATGAGACCTGTTGTCACATTCTCTACCCATGAGTTCACTTGACTAGCAATTTCAGG
AGCCTTATTCTGGAAGTCCACGGATTGGACCTCAGACTTATAGTTGCACACGGCGAGCTCCTGGAAGGAAGGCTTGAGCGAGAGCGACGCGTCTACAAAA
ACGCCGTTGGCGAAGGCGACGCGCGGGTCGCCGGTGATGGACGCATCGGCAAGCACTAACTGTACCACCTGCTCGGCGAGCGAGTGGAGTCCCTCGGGCC
CGCCTGCATTCTCGTTCCCAAGTATGGCTACGAGCTGGTCGCGGGTGGTGCCGCCAGCGCCGGCAGTAATGAGGCTGAGCGCGACATGGAGTGAGACCGG
GGAGAAGGCGACGTTGCCGGTAGCAGATTCGGGGTCGGATGAGATGGCGGAGGCGAGGCGGAGGGCGAATCGGGTCTGGTGCGCGACCGAGAGGCAGACA
TCGGTGGCAAGGGTGGTTGCCATGGCCGGGGTGGTGGTTCGTCGGACT
page-top