Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22920  (registered. 2007)
Contig Information
Length 1058 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 20S proteasome beta 5 subunit [Triticum aestivum]
Score 1373
Evalue 9.76183e-150
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22920
AAAGTCCGCCTCCGCCTCGCCGCACCCCCACACCCGCCGACGACGCCATGATTCCCAACCTCTCCGCCCTCGAGAACCACTTCGGCGCCGCCGCCGCCGG
CAGCGACGACTTCGCCGGCCTCTTCTCCGCCGACGCCGCCGACCAGCTCGCCCTCGAGTTCCCCACCTGCAACGACTTCGATGGGTTCCAGAAGGCGACC
AAGGAGATGGTGAACAACAAGAAGGGGACCACCACGCTCTCCTTCATCTTCGACAAGGGCGTCATCGTCGCCGCCGACTCCCGGGCCAGCATGGGCGGCT
ACATATCTTCGCAAACTGTGAGGAAAATCATCGAGATTAATCCCTACATGCTGGGAACCATGGCTGGAGGTGCTGCTGATTGCCAATTTTGGCATAGAAA
CTTGGGGGTCAAGTGCCGGCTCCATGAGCTCGCGAACAAGCGGAGGATCTCCATTGCTGGTTCTTCAAAGACGTTGGCTAATATCCTTTATTCATACCGC
GGGATGGGACTTTCAATCGGTACCATGATTGCTGGATTTGATGAAACTGGTCCGGGCTTGTACTATGTTGATAGCGAGGGTGCAAGGCTCAAGGGAAGCC
GATTCTCTGTTGGTTCTGGCTCTCTATATGCTTATGGTATCTTGGACGAGGGTTACAAATTCAACATGTCAGTTGAGGAAGCTGCTGAGTTAGCTCGGCG
GGCTATTTACCACGCAACATTCCGTGACGGAGCTAGTGGTGGCTGTGTTAGTGTCTACTATGTTGGCCCTGACGGCTGGAAGAAGTTGTCTGGAGATGAT
GTTGGAGAGCTGCACTACCACTACTACCCAGTCCAGGCGGCTCCTGTCGAGCAAGAGATGGCCGAGGCCCCTTCTGCGTCAACCTGATTGATGTCATACG
AAATTCCGTGAACTGTGTTGAAGCACCTTGTTTTATGGACTGGGGGCTTGTTTGTCTCCTCCTCGACATTAGAGTGTTCTCCTCCGAGACCTGCTGATGT
TCACCTTACGCATCTGTTATGGCAATGTGGTTGTAGACTGATGAATGTTATAGATGTT
page-top