Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22911  (registered. 2007)
Contig Information
Length 1031 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15904 [Oryza sativa Indica Group]
Score 686
Evalue 4.29784e-70
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22911
TTTTTTTTTTAGTACACATTTGCATAACTATAGTCAACTATTTATACATATGTCCAGCTACAGACATGATAAAGTGTATTACGCATTCGTACAAGCGCAT
AGATGGACAGCAAGACTGCTACATACACACGGGTACATATACACACTCATCTCAACAGCCGCGGCGCTATGATGGGATCACATCAGTATACATATGATCG
ACCCCACCATAAAGAAAAAAGAATACAAACGCTAAATCATTTAGCAAGGACCAGTAGCAGTACAAACCACACATACATACGTATTTAGCATCGCAAACAC
ACTCACTTTCACGACGATTTTGTCTAGTAATCATCAGAGCCAGTCTCGCCTGCACCAGTGGCATACCCATCGGCGCCGGACTTGCTGTAGCCACCACTGT
ACTCGTCGGCACCGGGCTTCTTGTAGCCATCATCAGTGCTGGACTTGTTGTAGCCACTGCCGTCATAGTCATCAGTATTGGGGGTGTTCTTGCCGCTGCT
GTAGTCCTCCTCGATGCTTGATTTGTTGTACGCGGGGGAGTCCTCGGTGCTTGGTTTCTTGTAACCGCCTTCGCCATAGCCGGCATCGGCGCTGGAGTTC
TTGTAGCCACCATCATAGTCGTCCGTGCTAGACTTGTTGTGGCCGCCACTGAAATCGTCGGTGCTGGACTTGTTGTAGTCGCCACCGGCACTGTAGTCGT
CGGCACCAGTTTTGTTGTAGCTGCCACCGCCAGTGTAGTCATCAGGGCTAGATTTATTCAAGCCGCCAGTGAAATTGTCAGTGCTGGACTTGTTGTAGCC
GCCACTGCTACTGTAGTCGTCCGTGTTGGTGTTCTTGTACGCACCATCATTGTTGTCGTTGCTGGATTTGTTGAAGCCGCCGGTACCATGGCCGTATTCA
TCGCTGCTGCGGCCATAGTCTTCCTCGCTGGTCTTGTTGTACCCGCCTTCGTCACTGCCTGTGCCTGACCTTCCGTAGCTGCTGCGATCATACTCATCTG
CCATCTCAAAATAAAGAGAAATGCATCACAC
page-top