Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22871  (registered. 2007)
Contig Information
Length 1139 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 8
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1253
Evalue 1.5985e-148
Total Hit Count 294
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22871
TCTGCCGGCCATGGCGATGTCGGATCTCGCGGCCGCGGTGATCTCCAAGGCCAACGGCGGCGTGGACGGCGAGGAGCCGGTGGAGATCCGGGAGGTGTGG
GCGGACAACCTGGAGGCGGAGTTCGCGCTGATCCGCGACGTCGTCGACGAGGTTCCCCTTCGTCGCCATGGACACCGAATTCCCGGGCATCGTCTGCCGC
CCCGTCGGCGCCTTCCGCTCCCCGGCCGACTACAACTACGCCACCCTCAAGGCCAACGTCGACATGCTGCACCTCATCCAGCTGGGGCTCACCTTCTCGG
GCCCCACGGGCGAGCTCCCTGCCCTCGGCGCCGGACGCCGCCGATGCGTCTGGCAGTTCAACTTCCGGGAGTTCGACGACGAGCGCGACATCTTCGCCAC
CGACTCCATCGAGCTGCTCCGCCACAGCGGCATCGACTTCCGCCGCAACGCCGAGCGAGGCGTCGACGCCCGCCGATTTGCGGAGCTGCTCATGTCCTCG
GGCGTTGTGCTCAATGACGCCGTCTACTGGGTGACCTTCCACGCGGGATACGACTTCGGCTACCTGCTCAAAATCCTCACCTGTAACAGCCTCCCAGACA
CACAGGCTGGGTTCTTCAAGCTGATGAAGATATATTTCCCCACCGTCTATGACATCAAGCATCTCATGAAGTTCTGCAACAGCCTGCACGGCGGGCTGAA
CAAGCTCGCCGAGTTGCTCGATGTGGAGCGTGTTGGAGAGTCACATCAGGCCGGGTCCGATAGCCTGGTCACGTCTTGTGCGTTCTGGAAACTCAAGGAT
TCCTTCTTTGCTGGATCAACCGAGAAATATGCAGGCGTGCTGTATGGGCTCAACGCAGAGAATGGTGTCAGTGCACATTGATGGATGATGCTCCCTTCGA
ATAGCTCTGTGAATGGGTTGATTTAGGACAGAAAGAGGTGGCGAGTGAGCTAGCAGGCAAAATGATGCCAACTTTGTAGGTTGAGCTTGTCTCACTCAAT
TAGTCAATTCCATTTTGTTGGATGTAATTTGAACGTAGTGTTTTTCAGTTGTTTCCATTGAACTAGTGTTTTCTGCTTATGCTGTTAGCTTTCTCTTGCA
TATTACTTAAATAGAAAAGTATCACCTCTAAAAAAAAAA
page-top