Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22850  (registered. 2007)
Contig Information
Length 1564 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27440 [Oryza sativa Indica Group]
Score 1058
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22850
CAATAAATATCAGATTTAACACGCTGCAAAATGTCTGCATAATGAAAGCAAAAGATACAATTTTATTCCAAGGAAGGTCACTAACTAATGTACCGAGTGA
GCAACGATACGCCTGATGCAGTATATTCCACTGAAATCCTAGAGTGTCTTCTCCTTATCCTTCCATGCTAATATTTGCCTATACAAGCAACAGGAGTAAA
AGACTCATCGAAAAGGTACTTGGGCACTTTTCTTCTCTTTCACAGACCAGCACAGGGTTGCTTCTTCTCCGAAAGCCAGAAAACCGGATGCAATGCCTGA
AGTGCAGGGCTTTCAAAACTGCCGCAAGATCTTCATCTATCAGTTTCTTCTGGTAGCTTAACATTTCCAAAATGTATCAGCTCCATCTCGTCTTTCCAAA
TGTTGTGTCGGAATTCAATCCTAATGTGAGGAACATTTGTCTGGTGGATGTCATTGCCGTCGGGACCTCTTTTATAGTAGTTTCTACCAATCCAGTGTGA
CTTCAGCCTATGAGAGAAACCAGACTGGTACACAGAATTCCTGGCTATTTCACACAAGTCACAAGAGCTAAGCTTCCACAGCGAAGCAGCAACACTGTAT
TCTTCAACCAAAGGTTCTTTTGTTAGGTGAATTTGTAAAGGGTCGTCAGTTGAGAGAGAAACATTCAGGCCTCTTAAGAAAAATGTTGGGAACGGGTTCC
TGTGGTAGTCAATAAACAACGAGTTGTTGCTCAAAGGAGACATTGCAAGACCAATCTGAGCAAGATAATACAAGTACTGGAGGACAGGGGACTTCTTTAG
ATTCACCCCGTGAGCAATATTGTGAGAAGTGAGAAATGCTGCAGCAAGATGATCAATATCGCCAGCCTCTCCACAGTGTGGACGAAGTTTGATTGTTGTC
ATGCCCTTGGGAGTCACGAAGCTTGTTCAGTGTGTAGAGGTTAGCATAGCAATAGTATACATAATATGCATACGCTGGATTGAAAACATTAGTCCATTGC
TCAGGAGTCGGCATGTGTTTTGTTGGGCGCCTTTCTGGTTTGCTTTCATCATCCACCAAATCTAAACCAACAACCTGTTCTAAGAAAACGTGCAGCTGAG
GATGTGAAGAAGGATCAACAGTTACTTCAAAAAGTGGAAGAAAAATGTTGTCAAGGAGGTTCTGGAATGAATTAATCGTGCCCATCTCCCTGTATACATT
GTAAATCCGAGGAATCTGGATTAACCAAACAACATTCTCGCTGTACAATTCGTTATTCACTATCCAACTTGCCATCTGATCCCACTCACTTTTCTTTCTC
CCATAAATAGATATTCGATACTCAGCCATCTGATATTTGCTTGCTTCAAGGTCAGCAAACACTTCTTTAGTTAATTCAGCGAGGAAGCGACCTTGAATAA
GGTTGTCCTGCTTAAGAAAGATCTCCCTGAGGCGAGACTGGCCACATGGATTATATTTCAGATTGAACTTGTCAAAACGGTGAAATGTACTCTTATCAGC
ATGCACGTCCAAGAGATCAACATTGAGGTCATACCCAGTCAAGTCCAAACTCTCGAACACCTCC
page-top