Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22840  (registered. 2007)
Contig Information
Length 1063 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1280
Evalue 5.99101e-139
Total Hit Count 399
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22840
TTTTTTTTTTGGTCCCAAAACATTCAGTTGCTATATAGTCAAAAACATGAGAAGTCTACGGAAGATGACAGGTGACGGCCACGCCCGTGTTTGGACCGGT
CCACCACCATAACTGGCCTGAAGAACACACGCAGCATCTACAGATTTCTCAACTGTAAATAAGTCGGGGTAACCTAAACAGAATTTAATCTCCGGTTACA
ACCACAACAGCCAGCCAGCCAAGCAGTATTGCGACTGTCTAGAAAGACTCAAGCTGTGCTGTAGCCATAACATGCTCCCAATGCTATCATGTATCAATCA
AAACCCGAAGAAACCAAGCTCTGTCGCCCTCTCCTTCTCGAAGGTCTCAAAGTACTGGTATATGATGGTGACGGCCAACAGAATACCGGTTCCTGAACCA
ATTGCGCCCATAAAATCAGCAAGAACAGTCAATGCGCCGATGCACACTCCACCAAATGCTGCGGCAGTAGGGATGTATCTGTTCAGTTCCTTCTGCAGGT
TTGACTCACGATGGCCTGGCATCACCATTTGTTGTTCCTTCAGCTGCTTAGCAACATCCTTGGCTGATGAACCAGAGACTTCAATCCATGTTTTTGAGAA
GAGAGCACATGCTGACAGCATGAAGACCACATAGAACAATGCATGGAATGGATTCGCCAGAATATCAGCCATACTTGATGGTGCAGTTACATAGTAAGCA
AGACCACCAACAGGGATAGAATGGCCAGAATATTCAGATTCTTTCCATATACCGAGAAGGTTAACCAGAAAGTTTCCACTGTACTTCCTGTAGAGAAGCT
GGGATATGAAATACAGGTTGGTAATCAGGGCAGAGTGCAGAATGATGGGCATGTTCGAAGTGTAGAACAGCTTAATTGGGTATGAGCCTTGCTGCCCACG
AGCATTCTTTGACCTCACTGGAAGCACAACACGGAAGCCTTGGAAATAGATAACTATGAGAAAGACCAGGACAGTAGCAAGCAAATTGGTCACATTTGGC
AGATTCTGACGGTAGAAAGCTTCTCGTAGGGCACGGACTTTGTCTGATCGAGTAATCAACAGA
page-top