Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22832  (registered. 2007)
Contig Information
Length 484 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 7
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_23923 [Oryza sativa Indica Group]
Score 132
Evalue 1.45658e-06
Total Hit Count 6
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22832
TTTTTTTTTTGCTCAGTGAAATCTATGCATGGTTCCACTGATAAAAGAGTACATAAACAACAGAACACACGCGATTTATACACCGTACACGGAAGGGGGT
TGGATTTTATTACTATTACGCGGCAGCGGCTAGTACGCTAAGCTAGACGGCGTTCGCCTCCCTCAGAGGAGGGCGGCGACGATGGCGGCTTCTCAGGTGC
GCTGAGCCAGGCGCTCGTTGTGCCTGTCGCGCTCGCGCTGCCTGTCGTCCTTGCCCATGAACATGAAGTAGCCGACGGTGCCGACGGTGAGGAGGCCGCC
GACGGCCATCGTGGTGGGGCTGAAGCGGCGCATGGGGCTGGACGGGCTCGTCGCCGACGACGACGCGCGCTTCAGCGGGTCGTCGGCCATGGAGGCCCAC
GCCTTCATCTCCGGCCACATGGTGGACGGACGATGCTCCTCCTCTTCTCGCTGCCAAGCTGCAAACTCCGGCCAAGCTTTCTTG
page-top