Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11798  (registered. 2012)
Contig Information
Length 828 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473383|ref|NP_001060290.1|| Os07g0618800 [Oryza sativa (japonica cultivar-group)]
Score 310
Evalue 2.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11798
CGCCGACGCGTCAAAGCTCCTCCTTCGTGACCAGATCGACGGTCGCCCCACCCTCATCGCTCTTCCCCTCGGGCGCCGGCAGATCCACGCGGGCGGCGAC
CCTCTTCGTCGGCGGTTCACCCTACCCGACGCTCGTCTCTTGCCATGTCTACAATGAAGGGACAGACAAGGAGGGAGAGGCCTAGGACTCGTCCTCATGG
CCTCACGCAACAGAAGAGGCAGGAAATAAAGGAAGCATTTGATCTTTTTGACACCGATAACTCTGGAACCATCGATGCCAAGGAGCTGAATGTTGCAATG
AGAGCCTTGGGGTTTGAGATGACAGAAGAGCAAATCAATCAGATGATTGCTGATGTTGACAAAGATGGCAGTGGATCGATAGATTATGAGGAGTTTGAGC
ACATGATGACTGCCAAGATTGGGGAGAGGGACACTAAAGAAGAGCTTACAAAAGCGTTCCGCATTATTGACCAAGATAAAAATGGGAAGATTTCAGATGT
TGATATTCAGCGTATTGCCAAAGAGTTGGGTGAAAATTTCACTCTCCAAGAGATCCAAGAAATGGTTCAAGAGGCAGATCAAAATGGCGATGGCGAGATA
GATTTTGGCGAGTTTGCGAGGATGATGAAGAAGACCAGCTATGGCTACTAGGCAGGGATGGCATCTGCGAGCGTCTGAATCTTTGTGCAGTTGTTCAGTA
ACCACCGTGTGTTTGCCTGATGTATTTACTGTTCTGTTTCCTCCGAGTGATCCTGTTGAACTCTGTGTACTTGTTATGGTAACATAATATTTCTGCAATG
GAGGTGTCCGACCGCACCGTCATCTACC
page-top