Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22810  (registered. 2007)
Contig Information
Length 1739 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0512300 [Oryza sativa (japonica cultivar-group)] >gi|42408800|dbj|BAD10061.1| putative Rab geranylgeranyltransferase, beta subunit [Oryza sativa Japonica Group] >gi|113624186|dbj|BAF24131.1| Os08g0512300 [Oryza sativa (japonica cultivar-group)] >gi|215717111|dbj|BAG95474.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201440|gb|EEC83867.1| hypothetical protein OsI_29853 [Oryza sativa Indica Group]
Score 1441
Evalue 1.82172e-164
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22810
TTTTTTTTTTAAAGTACTTGATGGCCGAATATTAGCAGCAAATAAAGCTCCAAAACAGAGTTCATACAGTTGGATAGATTGGTCATGATAGCAAAACTCC
TGGTACAACTAAAAGCAACGATAACAGGCCTACTAAAGTGCAGGTTTCTGGAATAAGCGAGTTGACAGATGAGAAGAATGGCGCCACCATGCCAAGCAAG
TACGCCCGCAGTCAGCCGCAGCCAAAGACACACATAGGAAGCTACAGCACACCGTCACCACCCCCATCAGCCTACTTGGATCGCTGCCTCATCTTTCGGC
GCTTCCTCTTCAGCCTCCTCATGCGCTTCTTCTTCCACTTGGCCCTCATGGTCGGTCGCCTCCTCGCGAGATCTCCTTCTCGCCCCTGCTGCTTCTCCTC
CTCCTGCGGCGGCGGCGGCGGTCTTGTGGTGGCCTCGTGCCGAATTCGGCACGAGGTGATCCCAACACGCTCGCGGCGGAGAAGAGCACAGCAGTCGTCG
ACGGAGCATCGCTAACCAAGCGAAGCGAGGAGGAGGAAGCCATGGGTGAACAGGGGGAGCTCGCCGCGGAGAAGCACGTCCGCTACATCGTCACCGCGGA
GAAGAAGAAGGACTCGTTCGAGTCGCTGGTGATGGAGCACCCTCCGGGCCAGCGGCGCCTACTGGGGCCTCACCACGCTCGACCTCCTCCACAAGCTTCA
CGCCGTGGACGCCGCCGAGGTCGTCGACTGGATCATGTCGTGCTACCACCCGGAATCTGGTGGGTTCGGGGGGAACGTGGGGCACGACCCGCATGTCCTC
TACACGCTCAGCGCCGTGCAGGTCCTCTGCCTCTTCGATCGGCTCGATGTTCTTGATGCAGACAAAATTGCTGACTATATTACTGGACTTCAAAATGAGG
ATGGATCATTTTCTGGTGATATTTGGGGTGAAGTTGATACTAGGTTCTCGTATATTTCCATATGCACCTTGTCATTACTGCATCGTCTGCACAAAATTAA
TGTGGAAAAGGCTGTAGAATATATTGTTAGCTGTAAGAACTTGGACGGCGGATTTGGAGCTATGCCAGGAGGGGAGTCTCACGCTGGGCAGATATTCTGC
TGTGTTGGTGCTCTCGCAATCACCGGCTCTTTGCATCACATTGATAGAGATCTCCTTGGATGGTGGCTCTGTGAGCGCCAGTGTAGAGATGGAGGGCTCA
ATGGGCGTCCTGAGAAACTTGCTGATGTGTGCTACTCATGGTGGGTGTTATCAAGCTTGATAATTATTGATAGAGTGCACTGGATTGACAAGGAAAAACT
TGCAAAGTTCATATTGAACTGTCAGGACAAGGAAAATGGTGGAATTTCAGATAGACCAGATAATGCGGTCGATATCTACCACACGTACTTTGGAGTTGCA
GGGCTTTCATTGATGGAGTATCCTGGAGTGAAGCCTATCGATCCTGCCTACGCCCTCCCTTTAGATGTTGTCAACAGGTTCTTCTTGACAAAACAACAGT
AGTGTGCCTTAGCTAGGAAGATCATGTTGTGACTGCGTTGGCGTCAGGTCAGCACGAGTGGAGAGCTTACCCCTCCTTCGGTAGCTCGCACTGATGTTTC
TGATCACTCCCATGCATGAGATCATGGCTTTGAACGTTTGATGATATAGTGCAGGCCTCATATTTACCAGGAAATCCGGACACTTGGTTATGTAGAAGAG
TGTAACGTCCAAGGACTGAGAATCAAATTCAATCAAGAT
page-top