Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22803  (registered. 2007)
Contig Information
Length 1866 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0611200 [Oryza sativa (japonica cultivar-group)] >gi|6646868|emb|CAB64600.1| S-adenosylmethionine decarboxylase 2 [Oryza sativa (japonica cultivar-group)] >gi|47497185|dbj|BAD19232.1| S-adenosylmethionine decarboxylase 2 [Oryza sativa Japonica Group] >gi|47497608|dbj|BAD19677.1| S-adenosylmethionine decarboxylase 2 [Oryza sativa Japonica Group] >gi|113536935|dbj|BAF09318.1| Os02g0611200 [Oryza sativa (japonica cultivar-group)]
Score 1589
Evalue 1.90166e-174
Total Hit Count 365
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22803
ATTCTTATATTCATAAACCATGCAGCCAGAGACAGGCATTTCCATACATTCGCTCACACTGGCAGAAAACGCTAACCATTTTCACGTCACTTGTCCATAA
CAAAAGTAATAGGACAGGAACAGGAAATCTCTAAGAACAAACTGACGCAACACAAGCTCGTTCAGACCAGCTAGCATCACCATCAGCAGCTCTTCATCCT
CTTAACAGCCCCCCTCTCATCCTTCTCCTGCGCAGCATCGTCTTCCCAGCAAAGGAAAGCATCCATCTTGGAGCCGCTCTCTAAATTGCCATGAACGTTG
CAGTTCAGGACAGATCTTGGTGACCCGGTGGAGTCTTCGCCGACAGCAGTGAAGCTCTGGTAGATGAGAGCGCCCCCGTCAGGCAGCTCCTGGACGACCA
TGTTGGTACTATCATAGACCCCAACATTCAGCCTCTCCCCCCAGGTGCCAGCAAGGTTGCGACCGCCAAAGATGGTCACAGCAACAGAGAATTCAGACGG
GCCAAAGGATCTCAGCACCCTCTTGACCAGGTCACCATAGGCCATGGAGGCAGGGTCCAACCCCATGACCTCATAGCTAGCATAGCTGAAGCCGTCCTCA
GGAGTGACATGAATGGTGGAGAAAGCAGAGCCATGGATGGCGTTCATGGAGTAGCCACATGGCTCGAAATCAAAGTCACAGATCTCCATCTCCGGGATTA
TTTCAGAGATGCCAGAGAGCTTGGTCATCTCCTTGGCACAAGATGTGTAGCCATCAGCAGAGGTCTTGAAGAAGACAGAAGCTTTCTTCTTGTCCAGACC
AGTCATGCACATCTCAAGGTTGACCATGGGCTGCTCAGGCTGCTGGGTGGCATAGTAGACATGCCACTTCTGGCCTGGCTTTGCAGGATCACCAATGACA
TAGGCATTGCCGCCAGACTTGAGTCCACCAAAGTAGCCATTCAGGAAGGCAACCTCATCAGAGAAGTTCTTGTGTGGAGAAGGCTGTGCCTCAGGGAATA
TGAATGTCCCACGGGAGTACTTCACAGCAGCAAGTGGCAGGGACAACTCCTCAGCAAGCTCAAGAATCCTTGGAATGGCCAGCAGGAGCTTGGTGTAACC
GCAGGTCTTGATCACAACCTTGTACGGGTAGATGAAGAGGCTTGATTCAGAGAGGACATACGAGTCAATCTTGTCATTAGAGAGCTCAGATACAATGGTG
CACTTGGCAAGATCAAGAACCGAGTCGATCTGGGCACGAGAGAGAGCACGCAATCCCCTGCCATTGGGGTCAGTGAAGACTGGCGCTTCAGAGAAGGTGA
TCTCCAGGCGCTTCTCATATCCCTCAAACCCAATCGCAGAGACGGCCATTGTTTGAGAAGGTTGGTAGAGGAGGAAAGGCTTTGCTGGTCAGAGAAAAGC
AGCTAGCCAGAGAAATTTTAGGAAGATGAATTGAAAGCAGAAGGGAATTCTAAGCAATTAGGATGGGGGCGCGAGAGGGATTATCAGGATGGCTTCCTGG
AGCAGTTTGAGTAGGCAGAGGAGCGGAACTTCTCAATGCCTCCTGCAGGGCGGACGTCCTCGATGCTGTAGCCGAGGGGAGCTTCGTACATGAGGGAGGA
ACGACTACTGCTGGACTTTTTACCACCCTTGGATTCCATAGCACATCAAATTAGTTCCAGGAAGAACCTCGGAGGCGCGCGTCGAATCTGCTGCTCGTCC
TCGTCACAAACCTCGAACAGGGAGCAAGCGACGGATCTGTCTCTCCCCCCTCCTCACAGATCTCGAAGAAACGAAAGCGAACGGACGAACACAATCTCAC
TCCGAATTTCTAGGTTTTCGACGAGATGGTGGTGGGGAACGAACGGAGTTTGCGTTTGTGCTAAAA
page-top