Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22799  (registered. 2007)
Contig Information
Length 445 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 11
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein FG09779.1 [Gibberella zeae PH-1]
Score 82
Evalue 0.938691
Total Hit Count 19
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22799
TTTTTTTTTTAAAACATAAATAAGTCATACAAGCATCATAATACAAGCCAGGGGCCTCGAGGGCTCGAATACAAGTGCTCGATCATAGACGAGTCAGCGG
AAGCAACAATATCTGAGTACAGACATAAGTTAAACAAGTTTGCCTTAAGAAGGCTAGCACAAACTGGGATACAGATCGAAAGAGGCGCAGGCCTCCTGCC
TGGGATCCTCCTAACTACTCCTGGTCGTCGTCAGCGGGCTGCACGTAGTAGTAGGCACCTCTGGTGTAGTAGGGGTCGTCGTCAACGGTGGCGTCTGGCT
CCTGGACTCCAGCATCTGGTTGCTCTGGCAAGGAGGGATCGTCAACACCGTAGTCGAACTGGGGGTCGCCGGCAGTCTCGGGGTAGCGGTGCTCACAGAA
GACTCGAGGAGGACGGGGTGGCGCCGAAGCGGTGGTGTCCGCCGC
page-top