Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22792  (registered. 2007)
Contig Information
Length 1349 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 3
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dehydrogenase/reductase SDR family member 2 [Zea mays]
Score 1039
Evalue 7.46724e-111
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22792
AATTTACAATGAAGGCCAAATATTCCAAGTATGACTAATAAGCCGAAGCAAGAAAAACAGAAGTAGAAAGAAAATAGCATACTGAAGACTCGTTCGAAAT
CTGGAAGGGTGCAAGTATGAATGAGGCAGGGAGACTAAGTACAGCAATTCAACCTGCAATGTTTCATTGGCTCAAAATAATCACTAAACCGCTGAAAAAC
TGAAACCCCAAATAAAATGCTGCGGCATACTCTGTCACTTCTTCGAAACAGGCTTTCACCCCGCTTTATAGATAAAGCATCAACCGCAATTCCTCTGTCA
CTTCACCGCAATTCCTATACATGAACACAGGTCATACAACAATAAATGTTCAGACGACAATGCCAATAGACTATAATTCGTCCTCGCAAGATTGTATGGC
GCCCCAACATCAAATTTATTACACTGCATCTTGTTTATATCTCAGCGCGCTTGAAATGTTGTATACTAGACCTACTAGTATCACTATATTTATTGATCAT
GACACTGTAGCTGATTGACCCTCAAAACGTATCTATAGTCTTGATTGTGTTCCTCCGGCAACAACAATTGTTTCAGCTGTAATGAAGGATGCATCGTCGG
ATGCCAGGAAAGCGGCGGCTGAAGCCATGTCTTCCACACTACCCAATCTCTTAAGTATGCTCCTCTCGATAAGTTCATTTCTAATGGTCTCATTAGTTGT
GAGGAAACCAGCAAAACGTGTAGGAACAAACCCAGGAGCTATACAGTTAACACGGGTATTTGGGCCCATCTCAGTAGCAAGAGCCTTCGTGAGACCAAAA
AGGGCAGTCTTTGTAACACCATACATCGTTAAAGCTGCATCAGGATTATAGCCAGCAATTGAAGAAATTAGTATCACAGATGATCCCTTCCTCAAATGTG
GTGCGGCGTCCTGAAGTAGAAGAATAGAAGCTTTGACATTAATATCCCATAGCTTGTCAAGAACTGACTCTTTCATCTCTAGTATGCTATCCACAGAAGG
ATTTGCAGCGGCATTGGAGACAACAATATCAATATGTCCGAAATTCTTGACGGCCGTGTCGACGAGGTGCTTGCGCTGCTCGGCGTTGGAGACGTGGCAG
ACGGCCCCGACAACGGTGATCCCCTTTGCCCTGAGGCCCTCCACCGCCTCGTCCACGTTTTTCTGCTTGCGGGAGGAGATGACGACCGCGGCGCCCTCCA
GGCCGAGGCGCTCGGCGATGGCGAGGCCGATGCCCTGCGTGGAAGCCGTCACGACGGCCACCTTCCCCTCCAGACGCCGGCACTTGACATCCATCGCCGG
CCTCGCCGTGTTTCGTTTGCTACGCGCCGCTGTCTTTCCCGATGGAAGC
page-top