Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11793  (registered. 2012)
Contig Information
Length 1177 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_DPA20 Seed DPA20 2
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222631552|gb|EEE63684.1|| hypothetical protein OsJ_18502 [Oryza sativa Japonica Group]
Score 270
Evalue 3.00E-70
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11793
GAGAACATGAATGGTTTAGCTGGACAGTTATTTTCTGGACCTATTCCTGCTGTGGATATGCTGCCAAAGGAAAAATGCAATTCTATTGGATCTCCTGAAG
CTAGAAATTTGACTGCCAATCACAAAGTTGATAATGGGAACATTGGCTATGTGTCTACACCAAACGGAACAAATGCATCCACCATCATGCCTCAGTCTAG
AGAGGGTGTGGATTGTTTACCATCGCACATCAGACCATTGAGCAACTATTCCCTCTTGGATGGACCACTTGATAATGGGTCACCTTCTCCCGCAAGTAAC
GAATCATGCGGGCCTGAAATAACCAATAATTCTCTAGTCAGCAATGGTGCCATTACTCATATCCCAAATGGAGGTCACACGGGCGTCAATTCTGGACAGA
ATGAAACACCTGGTTCTCAGAACTCTGGAGAGTTTACCCAGTATTTCCAGGAGGGCTATTGTAAAATATCAGAACTCGATGACTGCCGTGAGTTAACTGA
AGCTGTTACTGATGCTGACAGCAGCAGCAGCCACTGCGAGAGAGAGAAGCCCGAGGAAGATGGGGACAACGATGACATGCTTGGAGGGGTTTTCGCCTTC
AGTGAAGAAGGTTGAACTTACTATACTGCTTTACTTGGGATAGATAATGGTAAACAGTTGCCACAACATTCAGTGTGCAATATTATGTAGAAAATGGTGG
AATTCTAGTAGGCTTCCGTGGAATAAAGTTGTGCCGCGTCGATAAGCTAATGTTTGGTACATATTTGGAAGGTGAAGCTTGCGCTCCATGTTTATTTGCC
GGAAGGGTTCACTCTGGAGTTTGTGTCGAAGATCCCTCCAGGCAATTTACTAATCCACGGAAGGAAGGGAGTTTGGTGTTTGTCGAGAAGCTGCCACTGC
CTGCCGCGACACTTGGCCCGCCCTTTTTCTGTTTGCTTTGTACATACTGTAAGACCCATTTGTTTCGTGAGATACACTTCTGGGACATTTGGATGGGTCT
GAAACCCTGGCGAGCCATATTTGTTGACTGCTTCCTGCCAAGGCCTGTGAATGTTCCATGTTTATTTGTACATACTTTCATGTTTTATTAAGAGAAAGGA
ATGCTAGCAACGATTAATGTGACATAACTGTATAAACATTCAGTGAAAGATTTCTGTTTACGAAGTCAAAAAAAAAA
page-top