Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22764  (registered. 2007)
Contig Information
Length 1518 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_36525 [Oryza sativa Indica Group]
Score 1306
Evalue 9.57967e-142
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22764
TTTTTTTTTTGTAAATGTATATTTTCCAACTCACCAAAGTTACAGTTGCATGAATCTAATTAACCCTTTATTCCAACGATTGCTGTAGTAGGAAATTCAA
CAGGTTCCAAAATTGCACCATACGGCATTAAGCAAGCAATCCAGGATGCATCCACACGTCAATGACCATGCTTTTTAACGACATAATACATCTGAATCAT
TTGGCAATGACTTTCACAGTAGCTAGTTACCGCATATGATTAAAACTCAACCAGGAGGAAGAATTTCTCACGCAGAAACTACTTCTCCGGTGGTGAGGTC
AGCTGCCTTAGGTTGAACTTCGAAAGCTCTTTGTATCTCTCCACCACTCCAATCATGCATATAGTCTTGGCAATCTGGACAATAATAGTCTTGTCGGGGT
TGCTGAGGTCAACTTTGTGAGGTTGAGGTATAGATTTTGCAACTGCATTTATAATTTTCATTCTATCGATTCCTGTGTTTGACCTTGCTTCGTATAACAC
AGCAAACTTATGTCCCGAAGGAGATTCTTTGGGGAAGTACTTTTCAACAAGTGGAGCAATGGCTCTTGTTATTTCCTCTTCTGAAGCATAACATACCACC
TCAGCAGGCAACACCCTCAGAATAAACCTGGACATATGTTTACGAGTTGAAGCAGCCGAAGACATCATGCTTTGTACAATCTCAACTGGACCAGGGTCTC
CATCTCTTTTGTGCATTTGAATGAAGATGCAACCATTGCAACCGGAATCAACGCTTGCAAACAGCCTCTTTTTCCTGTCCCCCAGTTGTTTCAGGTCCTC
ATCAATTAAATCATCAATAGGTATGTCATTGGACGCTTTTGGTTTACCAGTGAACTCTTTCGGTTTATCGTTGGACGCTTTTGGTTTATCACTAGTCTCT
GTTGGCTTATCAGTGGACTCTTTTGGCTTATCATCAGTAGTCTCTGCTGGTTTATCAGTGGACTCTTTTGGCTTATCATCAGTAGTCTCTGCTGGTTTAT
CAGTGGACTCTTTTGGAGTATCATCAGTAGTCTCTGTTGTTTCATCAGTGGGCGCTTTTGGTTCTGTCTGTTCAGAAACCAGAGGATCTTCTATACGTTG
CTTCTTTGGCGCTGATCCACCAGCAGTTTCCACTTGTTCTTCATCCTCCTTGCTGGCAATTTCCAAGGCACCAGGTACCTCTTGTTGCTGCTCAGATGAC
TTGGCTTCACCTTTTTCTGCATCATTTCCATTGTTAGCCTCCTCCACTGGATGACCTTCATCCTCGTCATCAGAGGAATCAGAGTCGTCAAACTTTATCT
TTTTGTTCAGCGGCTTGTCAGGGATGCTCTTGGGCTTCTCATCAAATACTTTCCCGTCAACCAGGTCCTCGTAGAAGGTGTCCAGGAGAGAGATGGCCTC
GCGGGTGGCCTGGTGCTCGCGGCCGCCGTCGCAGGTGATGAAGAAGCCCTGCACGCCGGGGCGCAGCGGGTACGCGCCCTTCCGCACCGGCTTGCCGTGG
GGCAGGAACTTGCGCTTC
page-top