Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22702  (registered. 2007)
Contig Information
Length 521 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195610634|gb|ACG27147.1| hypothetical protein [Zea mays] >gi|195656031|gb|ACG47483.1| hypothetical protein [Zea mays]
Score 156
Evalue 3.00531e-09
Total Hit Count 43
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22702
TTTTTTTTTTCAATCAACACGCTTCTTCACCAGATTTGCAGGCAGGGATTGGATTACAAGCAGATTGATTACATGGAGGGGATCGATTTACCGAGCAAGA
GAACAGCACGCGGACAGGCAAGAGCTAGCTAGTAGTATTGGTAGTACATGGCGCATCTATGGGGTATGGGGTGTCAGTCTAGCCGGCGTAGATGTGGATG
TGGAGGGCGAGGGTGAGGATGGTGAAGGCGGCGAAGAAGAGGAGGGTGTGGACGAAGATGGCCTTGCCGTTGGTGTGGAGGCCGCCGAAGTCGACGTGGC
GGTGCGACCCCGGCATCTCGAACAGCAGCCCCGGCGAGAGCAGCACGAACAGCACCACCCCCACCACCACCGGTGCCCAGTCCGCCATCCTCCGCCGCTT
CTCCTTCTTCCTTGGACTTCGGTCGATCTGATCTGATCTGATCTCACGGCCGCAGATATGGATCTTGGTTGTGAACACGCAGGAGCGCTCGGGAAGGGTC
GGCAGTGGAGTGGGGGAGTGG
page-top