Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22689  (registered. 2007)
Contig Information
Length 1288 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DAG protein [Zea mays]
Score 665
Evalue 1.62396e-67
Total Hit Count 92
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22689
CACCGCCCGCCCAGGAGACGATCCTCCTCGACGGGTGCGACTTCGAGCACTGGCTTGTCGTCATGGAGCCGCCCCCAGGAGACGGCGCCAACCCCGATGT
CACCCGCGATGAGATCATCGACGGGTACATCAAGACCCTCGCCCAGGTCGTCGGAAGTGAAGACGAAGCAAGGATGAAGATCTACTCTGTGTCAACTAGG
CATTATTTTGCTTTTGGTGCCCTAGTATCTGAGGAACTCTCCTACAAACTCAAAGAGTTGCCTAAAGTCCGTTGGGTTCTTCCTGATTCATACCTGGATG
TCAGAAATAAGGACTATGGAGGAGAACCATTTATAGATGGACAAGCTGTTCCTTACGACCCCAAATACCATGAGGAGTGGGTGAGAAACAATGCCCGTGC
CAATGAAAGATCCCGGCGCAATGACAGGCCTCGCAACTTTGACAGGTCGAGGAACTTTGAAAGGAGAAGGGAGAACACACAGGCCTACCAGAGTGGGCCT
CCAAACCAAATGCCACCCCATGATGCTGCTCCTCCAAGTCGTGGTGCACAGGGCCCGCCACCGCCTTCAGGTGCTCCACCAAATTACCAGCCCCATGCAC
CAAACCCACAGGCAGGCTATGCTGCAGGAGGTGGACCAAACTATCCAAATGCACCACCACCCCCTGGATACCGAGGTGCCCCAGCCCCTGGCTACCAAGC
TGGTAACCAAGGTTACCAGGGTAATCCTGGTGGCAACATGCACAATGGACCAGGCCCAGCCTACCATAGCAACAACCCTGGATACCAGGGTGGAGCGCCA
GGAGGCAACCCGCCGCCACCTTTCGCAGGTGGCAACCAGCCTCCTCCCTACCATGGCGGTGGTCCTAGCTATGGTGGTGGTGCACCAGACTACCAGGGCC
AACCAGGTGGTAACCCAGGCTACCAAGGTGGCGGTAACTACAGCAACGCCGCCCCTCCTCCCTATGAGGGCAGGGACGGGCCAGGGAGGAACTACCAGTA
GAGAAGACTGGTAGAAGAGCGCTGTGTAGGAAGTTAGTAAGAGCTATGCTCGAGTCGCCCTATGTTGTTCTCGTGGACTTTTATGCATATATTCTCTATC
CATCATGGTGTTTTGAGAACTAGAACTACTGCAAGCTTAGGTAAGAAGTGCTTTGTTTTTTTCTCTTTGTCGAAATAAATACAATGCTGACTATCGTATG
GAACCAGAGCTTTGTTATTTGTTGCCGTATTGTAATAGCAACATGTTCTGTGTGTTCTATTGAATCACTTTTATATTCAAAAAAAAAA
page-top