Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22656  (registered. 2007)
Contig Information
Length 1003 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_029111 [Oryza sativa (japonica cultivar-group)]
Score 120
Evalue 0.000177691
Total Hit Count 6
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22656
TCATATATTTTAGTACATAGTTTGACCGTGTCTTGCATACCAGAGCAAAACATAACAGTATACGAAGGAAAACACGGGTAAGTGAAGGGCACAACAACGA
GAATTTAGCTATATAAGTCGTCATCTTCAGCTGCTGCGGCAGCGGATGCAAAAGGGTCGGCGGCAGCAGAAGAGGCGGCGCCCGCGGCCGGCTGATCAGG
GAACCGGAACTCGCTGCCGAAACCACGAGACTGCTGCAGAGTCTCCTCGTGCCGAATTCGGCACGAGGCGTCATCTCTTTCCTCCCCCCTCGGCGCAGCA
ACAGAGGTACGAGATGGCGGCGGTGGCGACGACGACGGCGGTCCACGGGAGCCAGGCGGCCGGCGCGCAGAGGCTGCTGCTTCTCCTCGCTCTCGTGATT
GAAGCTGTAAACAATGGAGCAGATATCTTCACTGAAGACCAGCAAGAAATTATCAAGCAATTTGGCAGAATCAAATCCGAGACTGTTCCTGAGAACAAGG
ATGCAGGGTCTGATGACGATGATGACGATGATGAAGATGAGGATGATGAAACTGGTGATGCTGATGATGATGATGCCGATGCTGGAGAGGACTTCTCGGG
TGAAGAAGGCGAGGACGATGACGAGGATGATGACCCTGAGGCGAACGGCGATGATGCTGGCGCGGGGAGCGATGATGATGATGGTGACGACGACGATGAT
GATGGTGAAGACGGCGAGGATGACGATGATGATGACGAGGATGAGGATGAGGAGGACGAGGAAGATGAGGACCAGCCACCGGCCAAGAAGAAGAAATGAT
CTGCCTTCCTGCTGTCAGTGTTTCAGTCCGTTAGTTTATCTGCTGTCTAGATGTTGATTGAGCGGGTCTGGTACACACCGACCTATGTAGCTTCTGTGTC
TTGGTGGTTTGGTGTCTCATAGGGTAGAACATTGAACTTCTAATGTTGTTTCCTGCGTTGTGCAAGTAGTCTTAACATTTCGGTCTTGATATGCTGTGTT
TAT
page-top