Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22637  (registered. 2007)
Contig Information
Length 898 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0455800 [Oryza sativa (japonica cultivar-group)] >gi|42409139|dbj|BAD10407.1| unknown protein [Oryza sativa Japonica Group] >gi|113623932|dbj|BAF23877.1| Os08g0455800 [Oryza sativa (japonica cultivar-group)] >gi|125561770|gb|EAZ07218.1| hypothetical protein OsI_29463 [Oryza sativa Indica Group] >gi|125603639|gb|EAZ42964.1| hypothetical protein OsJ_026447 [Oryza sativa (japonica cultivar-group)] >gi|215692595|dbj|BAG88015.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708689|dbj|BAG93958.1| unnamed protein product [Oryza sativa Japonica Group]
Score 962
Evalue 3.40601e-102
Total Hit Count 360
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22637
GAGTGAGTGTTTGACAAAGGATAACTACACAAGCAAGCTCAAACTTTATTCCACTAATTGTGATACATAAAATGTTACAACCAGGCACCAGCACCAGCAC
AAGAGTGCTCTTTCAGAGTGACAAGACTAAAATACAGACCTCGTGCAATCACAGAAAATGGCATCCAAAGCCAATACAGGAAGGCCCGATAATGCCATAA
TAGACTGCCTGCAAGCAATATGAACATCTCTGATCGTTCTTACTTCTTGGAAGGAATAAGGTAATTGAGGAAGGGTTCTGCCTTCGGGGCAATAGATTTC
ACATCATCAAAAGAGGCCATTTCAAAATCTTCATACTCAAAGCCAGGGGCACAGGTGCAGCCAGCAAGGGAGTAGTGCTTCTCGGGGTCTCGCTTCCGAG
AGTTCACAAGATGGCTGCCATCGGATGCAAACGACTCAACATCCAACGTAGGGAAAGATCCAAACCACACATTTGGTGGCACGGTGTACTGGGGGCGCTG
CCCAGCATCTAGGTGCGGACCAATTACGGTGAGGTCAATGTGGCCATCGTCGTGTAGCTCAAATACCGTGAGAGGCTCTCCCTTGTAGAAATGCCAGGTT
TCAGCGCAAGGAATACGATGCAGATGTGAAACACTCCCTGAAGGAAGCAAGAAATAGATAGCAGTGCTCACAGCACGACCGACCTTGTACTGCGGCGGGA
GCTGGGCGGTGCTGAGGGAGACGGAGGAGTCGCGGAAGGTCTCGGCGTAGAAGCCGCCCTCCGGGTGCGGCTTCAGATCCAGCAGCGCCGCTACCTCCGT
GGCCGTCATCTCGCAGGAGCCCATCTCCTCTGGATCGACCGGCGGGGCTCCTCTCGCTGTCCGCTTCGAGGTTCCTGGCTTCTGGTGGCGAAGGCGAA
page-top