Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22584  (registered. 2007)
Contig Information
Length 896 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|125601289|gb|EAZ40865.1| hypothetical protein OsJ_024348 [Oryza sativa (japonica cultivar-group)] >gi|215769010|dbj|BAH01239.1| unnamed protein product [Oryza sativa Japonica Group]
Score 832
Evalue 4.0421e-87
Total Hit Count 46
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22584
CCCCCTATATACCTGCTACCCTACCCGTCGGAGGGTGCGCGCAGCGGTGGAGCTCGGTGGATTGTCGGGGCAAATGGATTCCAGGGCCGCCCTCTTCTGC
TTCCTGGCCGTCGCCTCCTCCCTCCTGCACCCCGCCAGATCTGACGGGGACGACAACCAGCTCCTCAAGGGGATCAACAGCTACAGAGCTTCGCTCAAGG
TCCCGGCGCTCACCGAGAACAGCAATGCCGACTGCCTGGCCGAGCAGCTAGCAAAGAAGTTCAAGGGCCAGGAGTGCACCAACACCACCGGAGCCAACAC
CGTGCCCGGCACCGAGCCGCAGTTCCCCGACTACCCCCAGTTTCTCGACCGCTGCCACCTCAACGCGTCGGTGACCGAGGACGGGCAGGTGATGCCGGCA
TGCGTGCCCGGCCTTGTGGCCGACATTGTGCTGACCAACTACACCAAGTCCCAGCACAACCGGTTCCTCAACGACACCAAGTACTCCGGCATCGGGATCG
CCAACGAGGGGGACTGGGTGGTCGTCGTCCTCAGCACCAGCACCGACTCCGGCGACTACTCCCCTGCTCCCCCGGGCTCCAACTGGGCTCCGTCGGTCCA
GCCGTTCAGCTGGATGATTGTTTCGCTGGTAGGGTTCGTAGTTTTGCTGATGAAGTGAGAAGATCGGTGTTGTGTTGTTCATCTCGCGTGCTACACCGCT
GCAAATGAGTGTGTTGATCTTATGCCCGTGCCAATCATTTCTGTATTATTCAGATTTCATTTCTACTTGATCCAGTTGACACCACAGTACAGTAGCATAT
GCATGCCACGAGGTTTGGGATCAAAACTTTTTCTCTCGCTATTTGCCTTTGACCACAATTGGCAATGGCTTTATGCATATTGTGGTTCAGGTGATG
page-top