Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22575  (registered. 2007)
Contig Information
Length 644 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 5a2 protein [Zea mays]
Score 167
Evalue 2.77043e-10
Total Hit Count 69
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22575
TTTTTTTTTTAGAAATCAGTCAACTGATTTTTAGTCGTTCCGTTTATTCTTACTATTATTATTATTGGGATCTCACGGTAACATGCCATGGCAGATTACA
TTTTATGACGATGACCATAGCTCACTAGCTCGGCATGCACGCACGCGCGGACTTTATTTATAGTTATTATTCTGCCATGAACCCTCCATCTCCTTCACCG
GCCTTCCTCTCGCGCGATCCCCATGACCGAAACTCCTCACGCATGCGCGGATGGTGGTGGCACCCGCCCCCCGATGGTGTAAGTTCCGCATTTGCTCCCG
ACGGGGAGTTCGATGTGGCATTCGTGGGCGAGGATGACGAGCTTCACGGGGCTGACGGTACGCTCGTCGGAGGCGGTGAGGACCCGGCAGATGCAGGGCA
CGTCAACCTTCTTCACCTCGCGGCGGCAGTCCGGGGTCGGGGGCGTGTAGAAGCCCTGCTTCTTGATGCTCTCGATGCAGATGCTCATGATCATGTCCCT
CTCGTCGTAGCAGTCCTTCTCCCCCGCGGCGAGATGCGCCGCGAACCCGGCGACGATCGAGGCCAACAGCAGGAAGCGGACGAGGGTGGCTCTGGCGCTT
CCCATCTTCGTGTGCTGCTGCTGAGCTGCTGGCTAGTGTGCTTG
page-top